Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs1800497 [Homo sapiens]
    TGGACGTCCAGCTGGGCGCCTGCCT[C/T]GACCAGCACTTTGAGGATGGCTGTG
    Chromosome:
    11:113400106
    Gene:
    ANKK1 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    A=0.3257/1631
    HGVS:
    NC_000011.10:g.113400106G>A, NC_000011.9:g.113270828G>A, NG_012976.1:g.17316G>A, NM_178510.1:c.2137G>A, NP_848605.1:p.Glu713Lys, XM_011542736.2:c.2170G>A, XM_011542737.2:c.2140G>A, XM_011542738.2:c.1948G>A, XM_017017475.1:c.2167G>A, XP_011541038.1:p.Glu724Lys, XP_011541039.1:p.Glu714Lys, XP_011541040.1:p.Glu650Lys, XP_016872964.1:p.Glu723Lys

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center