Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

1.

rs17140547 [Homo sapiens]
    GAGAACTATTCCTCCTGAGAGCTCC[C/T]TATTACTGTGTCGTGACTTGTTTTT
    Chromosome:
    11:80666008
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0723/362
    HGVS:
    NC_000011.10:g.80666008C>T, NC_000011.9:g.80377052C>T, XR_247271.1:n.44-150170G>A, XR_247272.1:n.44-150170G>A
    2.

    rs11264736 [Homo sapiens]
      AAACAAACAAACTTGTCAGCTCCAT[C/T]TGCTGTAAGAATTATATGAGTAACA
      Chromosome:
      1:153966654
      Gene:
      CREB3L4 (GeneView) SLC39A1 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.2973/1489
      HGVS:
      NC_000001.10:g.153939130C>T, NC_000001.11:g.153966654C>T, NM_001255978.1:c.-1515C>T, NM_001255979.1:c.-1661C>T, NM_001255980.1:c.-1515C>T, NM_001255981.1:c.-1661C>T, NM_001271960.1:c.-140+1430G>A, NM_014437.4:c.-140+732G>A, NM_130898.3:c.-1535C>T, NR_045658.1:n.-1185C>T, XM_006711172.2:c.-1535C>T, XM_017000372.1:c.-1113C>T
      3.

      rs11083866 [Homo sapiens]
        AGCTTCCTTGGTAAAATTGGGTTGC[A/G]GCCAGAGAGGCATGTCCCTAGCTTT
        Chromosome:
        19:29245435
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3025/1515
        HGVS:
        NC_000019.10:g.29245435G>A, NC_000019.9:g.29736342G>A
        4.

        rs10918196 [Homo sapiens]
          atttctccaaaggaccctaagtttc[C/T]tttatcagagaacaataattagaaa
          Chromosome:
          1:165478920
          Gene:
          LOC400794 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.4679/2343
          HGVS:
          NC_000001.10:g.165448157T>C, NC_000001.11:g.165478920T>C, NR_026744.2:n.1530-1805A>G
          5.

          rs10496584 [Homo sapiens]
            AATTTACATAAAAACTACACCATTC[A/G]TTTATGTACAAAAAGTCCCACATGT
            Chromosome:
            2:122368903
            Gene:
            LOC105373592 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.2528/1266
            HGVS:
            NC_000002.11:g.123126479A>G, NC_000002.12:g.122368903A>G, XR_001739684.1:n.556-24060A>G
            6.

            rs6941712 [Homo sapiens]
              AGACCAGGAGATTTGCCTGAGATGG[C/T]AAAGTCAGATGGGCAAGCCAAAACT
              Chromosome:
              6:130961070
              Gene:
              EPB41L2 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.2855/1430
              HGVS:
              NC_000006.11:g.131282210T>C, NC_000006.12:g.130961070T>C, NM_001135554.1:c.-14-4571A>G, NM_001135555.3:c.-14-4571A>G, NM_001199388.2:c.-14-4571A>G, NM_001199389.1:c.-14-4571A>G, NM_001252660.1:c.-14-4571A>G, NM_001431.3:c.-14-4571A>G, XM_005266840.1:c.-14-4571A>G, XM_005266841.1:c.-14-4571A>G, XM_005266842.1:c.-14-4571A>G, XM_005266843.1:c.-14-4571A>G, XM_005266844.1:c.-14-4571A>G, XM_005266845.1:c.-14-4571A>G, XM_005266846.1:c.-14-4571A>G, XM_005266847.1:c.-14-4571A>G, XM_005266848.1:c.-14-4571A>G, XM_005266849.1:c.-14-4571A>G, XM_006715362.2:c.-14-4571A>G, XM_011535524.1:c.-14-4571A>G, XM_011535525.1:c.-14-4571A>G, XM_011535527.1:c.-14-4571A>G, XM_011535528.1:c.-14-4571A>G, XM_011535529.1:c.-14-4571A>G, XM_011535530.1:c.-14-4571A>G, XM_011535534.1:c.-14-4571A>G, XM_011535536.1:c.-14-4571A>G, XM_017010349.1:c.-14-4571A>G, XM_017010350.1:c.-14-4571A>G, XM_017010351.1:c.-14-4571A>G, XM_017010352.1:c.-14-4571A>G, XM_017010353.1:c.-14-4571A>G, XM_017010354.1:c.-14-4571A>G, XM_017010355.1:c.-14-4571A>G, XM_017010356.1:c.-14-4571A>G, XM_017010357.1:c.-14-4571A>G, XM_017010358.1:c.-14-4571A>G, XM_017010359.1:c.-14-4571A>G, XM_017010360.1:c.-14-4571A>G, XM_017010361.1:c.-14-4571A>G, XM_017010362.1:c.-14-4571A>G, XM_017010363.1:c.-14-4571A>G, XM_017010364.1:c.-502+9213A>G, XR_001743213.1:n.169-4571A>G, XR_001743215.1:n.169-4571A>G, XR_001743216.1:n.169-4571A>G, XR_001743217.1:n.169-4571A>G
              7.

              rs6027511 [Homo sapiens]
                TTGCCCAGCAGCTAACTCTTGTAGG[C/T]GGAAACATGGTGGCTTCTTGTTCTC
                Chromosome:
                20:60323151
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.1747/875
                HGVS:
                NC_000020.10:g.58898209T>C, NC_000020.11:g.60323151T>C
                8.

                rs4848768 [Homo sapiens]
                  AGTCTGATTTTAAGGAATGGTATAC[A/G]ACCTCAGAGCCAAACTAACCTCCAG
                  Chromosome:
                  2:122383969
                  Gene:
                  LOC105373592 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.2808/1406
                  HGVS:
                  NC_000002.11:g.123141545A>G, NC_000002.12:g.122383969A>G, XR_001739684.1:n.556-8994A>G
                  9.

                  rs2252508 [Homo sapiens]
                    CCCTGAGCCGTGGCTCTTCTTCCCT[C/T]CCAGATGTCTCCCTATGACAACTTG
                    Chromosome:
                    1:153941294
                    Gene:
                    DENND4B (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.2949/1477
                    HGVS:
                    NC_000001.10:g.153913770A>G, NC_000001.11:g.153941294A>G, NM_014856.2:c.1123-5T>C, XM_005245678.1:c.1156-5T>C, XM_005245678.4:c.1156-5T>C, XM_005245679.1:c.1123-5T>C, XM_005245679.2:c.1123-5T>C, XM_011510219.1:c.1123-5T>C, XM_011510220.2:c.808-5T>C, XM_011510221.2:c.517-5T>C, XM_011510222.1:c.1123-5T>C, XM_017002993.1:c.883-5T>C, XR_241109.1:n.1304-5T>C, XR_426806.2:n.1146-5T>C
                    10.

                    rs2037892 [Homo sapiens]
                      TTCAAACAAGCCACTCTGCCATTAC[C/T]AGAAATCATATGTCTTATGTGACTT
                      Chromosome:
                      2:122370213
                      Gene:
                      LOC105373592 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      A=0.2815/1410
                      HGVS:
                      NC_000002.11:g.123127789G>A, NC_000002.12:g.122370213G>A, XR_001739684.1:n.556-22750G>A
                      11.

                      rs1919922 [Homo sapiens]
                        TAGAAATTATTTAGAGGTCTAGTGC[A/G]TAGGATATGAACTAAATATTCCTAA
                        Chromosome:
                        2:122379314
                        Gene:
                        LOC105373592 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.2462/1233
                        HGVS:
                        NC_000002.11:g.123136890C>T, NC_000002.12:g.122379314C>T, XR_001739684.1:n.556-13649C>T
                        12.

                        rs1795240 [Homo sapiens]
                          CTGACAATTGTTCACCTTTCGCCTT[A/G]GTTTGGATTGGCTTAGTGATCAGGA
                          Chromosome:
                          1:171122735
                          Gene:
                          LOC105371611 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          A=0.3582/1794
                          HGVS:
                          NC_000001.10:g.171091875A>G, NC_000001.11:g.171122735A>G, XR_001738291.1:n.1392-872T>C, XR_922278.2:n.1392-872T>C

                          Display Settings:

                          Format
                          Items per page
                          Sort by

                          Send to:

                          Choose Destination

                          Supplemental Content

                          Find related data

                          Recent activity

                          Your browsing activity is empty.

                          Activity recording is turned off.

                          Turn recording back on

                          See more...
                          Support Center