Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs1050450 [Homo sapiens]
    ATCGAAGCCCTGCTGTCTCAAGGGC[C/T]CAGCTGTGCCTAGGGCGCCCCTCCT
    Chromosome:
    3:49357401
    Gene:
    GPX1 (GeneView)
    Functional Consequence:
    missense,utr variant 3 prime
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Benign
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    A=0.2175/1089
    HGVS:
    CM000665.2:g.49357401G>A, NC_000003.11:g.49394834G>A, NC_000003.12:g.49357401G>A, NG_012264.1:g.5958C>T, NG_051308.1:g.59697C>T, NM_000581.3:c.599C>T, NM_001329455.1:c.461C>T, NM_001329502.1:c.*425C>T, NM_001329503.1:c.*105C>T, NM_201397.2:c.*581C>T, NP_000572.2:p.Pro200Leu, NP_001316384.1:p.Pro154Leu
    2.

    rs854560 [Homo sapiens]
      GCCAGTCCATTAGGCAGTATCTCCA[A/C/G/N/T]GTCTTCAGAGCCAGTTTCTGCCAGA
      Chromosome:
      7:95316772
      Gene:
      PON1 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      T(germline)/A(germline)
      Clinical significance:
      other
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.1827/915
      HGVS:
      CM000669.2:g.95316772A>T, NC_000007.13:g.94946084A>T, NC_000007.14:g.95316772A>T, NG_008779.1:g.12801T>A, NG_008779.2:g.12935T>A, NM_000446.5:c.163T>A, NM_000446.6:c.163T>A, NP_000437.3:p.Leu55Met
      3.

      rs7493 [Homo sapiens]
        GTTCTCCGCATCCAGAACATTCTAT[C/G]TGAGAAGCCTACAGTGACTACAGTT
        Chromosome:
        7:95405463
        Gene:
        PON2 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        G(germline)/C(germline)
        Clinical significance:
        Benign
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        C=0.2833/1419
        HGVS:
        CM000669.2:g.95405463G>C, NC_000007.13:g.95034775G>C, NC_000007.14:g.95405463G>C, NG_008725.1:g.34610C>G, NM_000305.2:c.932C>G, NM_001018161.1:c.896C>G, NP_000296.2:p.Ser311Cys, NP_001018171.1:p.Ser299Cys, XP_005250510.1:p.Ser243Cys, XP_005250511.1:p.Ser241Cys, XP_016867846.1:p.Ser241Cys, XP_016867847.1:p.Ser225Cys, XR_242249.1:n.1252C>G
        5.

        rs662 [Homo sapiens]
          CACTATTTTCTTGACCCCTACTTAC[A/G]ATCCTGGGAGATGTATTTGGGTTTA
          Chromosome:
          7:95308134
          Gene:
          PON1 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          other
          Validated:
          by 1000G,by cluster,by frequency,by submitter
          Global MAF:
          T=0.4571/2289
          HGVS:
          CM000669.2:g.95308134T>C, NC_000007.13:g.94937446T>C, NC_000007.14:g.95308134T>C, NG_008779.1:g.21439A>G, NG_008779.2:g.21573A>G, NM_000446.5:c.575A>G, NM_000446.6:c.575A>G, NP_000437.3:p.Gln192Arg

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center