Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs3849942 [Homo sapiens]
    GGTCTAGCTAGTACGTATTTCTTTT[A/G]TTGCATTTATTACACTATTCCTTTG
    Chromosome:
    9:27543283
    Gene:
    LOC107987057 (GeneView)
    Functional Consequence:
    nc transcript variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1825/914
    HGVS:
    NC_000009.11:g.27543281T>C, NC_000009.12:g.27543283T>C, XR_001746639.1:n.710A>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center