Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs34372695 [Homo sapiens]
    ATTTTTTGTATTTTTAGTAGAGACA[C/G/T]AGTTTCACCGTTTCTACCATAGAGC
    Chromosome:
    1:156060246
    Gene:
    RAB25 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0088/44
    HGVS:
    NC_000001.10:g.156030037C>T, NC_000001.11:g.156060246C>G, NC_000001.11:g.156060246C>T, NG_009898.1:g.10521C>G, NG_009898.1:g.10521C>T, NM_020387.3:c.-1155C>G, NM_020387.3:c.-1155C>T, NR_133653.1:n.-903C>G, NR_133653.1:n.-903C>T
    2.
    3.

    rs2942168 [Homo sapiens]
      CCTGTGGGGCTCTGGGAAAGAGCTT[A/C/G/T]GGCCTCACACTGGGTCACCTCCCCA
      Chromosome:
      17:45637484
      Gene:
      CRHR1-IT1 (GeneView) LINC02210-CRHR1 (GeneView) LINC02210 (GeneView)
      Functional Consequence:
      intron variant,nc transcript variant,upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.0863/432
      HGVS:
      NC_000017.10:g.43714850G>A, NC_000017.10:g.43714850G>C, NC_000017.10:g.43714850G>T, NC_000017.11:g.45637484G>A, NC_000017.11:g.45637484G>C, NC_000017.11:g.45637484G>T, NG_051340.1:g.4640G>A, NG_051340.1:g.4640G>C, NG_051340.1:g.4640G>T, NM_001256299.2:c.-493+7326G>A, NM_001256299.2:c.-493+7326G>C, NM_001256299.2:c.-493+7326G>T, NM_001303016.1:c.-261+7326G>A, NM_001303016.1:c.-261+7326G>C, NM_001303016.1:c.-261+7326G>T, NR_026680.3:n.1635G>A, NR_026680.3:n.1635G>C, NR_026680.3:n.1635G>T, NR_026905.2:n.-1491G>A, NR_026905.2:n.-1491G>C, NR_026905.2:n.-1491G>T, NR_026906.2:n.-1491G>A, NR_026906.2:n.-1491G>C, NR_026906.2:n.-1491G>T, NR_027295.2:n.2129G>A, NR_027295.2:n.2129G>C, NR_027295.2:n.2129G>T, NR_138257.1:n.1552+83G>A, NR_138257.1:n.1552+83G>C, NR_138257.1:n.1552+83G>T, NR_138258.1:n.433+7326G>A, NR_138258.1:n.433+7326G>C, NR_138258.1:n.433+7326G>T, NR_138259.1:n.1635G>A, NR_138259.1:n.1635G>C, NR_138259.1:n.1635G>T, NR_138260.1:n.624+6878G>A, NR_138260.1:n.624+6878G>C, NR_138260.1:n.624+6878G>T, NT_167251.1:g.1152431T, NT_167251.1:g.1152431T>A, NT_167251.1:g.1152431T>C, NT_167251.1:g.1152431T>G, NT_167251.2:g.1150438T, NT_167251.2:g.1150438T>A, NT_167251.2:g.1150438T>C, NT_167251.2:g.1150438T>G, NT_187663.1:g.339608G>A, NT_187663.1:g.339608G>C, NT_187663.1:g.339608G>T, NW_003871086.1:g.66574T, NW_003871086.1:g.66574T>A, NW_003871086.1:g.66574T>C, NW_003871086.1:g.66574T>G

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center