Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs324420 [Homo sapiens]
    CTGTGAGACTCAGCTGTCTCAGGCC[A/C]CAAGGCAGGGCCTGCTCTATGGCGT
    Chromosome:
    1:46405089
    Gene:
    FAAH (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    A(germline)/C(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    A=0.2616/1310
    HGVS:
    NC_000001.10:g.46870761C>A, NC_000001.11:g.46405089C>A, NG_012195.1:g.15823C>A, NM_001441.2:c.385C>A, NP_001432.2:p.Pro129Thr, XM_005270624.1:c.385C>A, XM_005270625.1:c.385C>A, XP_005270681.1:p.Pro129Thr, XP_005270682.1:p.Pro129Thr, XR_246250.1:n.463C>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center