Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs4788099 [Homo sapiens]
    TGCTAGAGAGAGTGCGTGGGAACAG[A/G]CAGAGTCCTCACCAGGGACGGAGTA
    Chromosome:
    16:28844406
    Gene:
    MIR4721 (GeneView) TUFM (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2616/1310
    HGVS:
    NC_000016.10:g.28844406A>G, NC_000016.9:g.28855727A>G, NG_008964.1:g.7003T>C, NG_029706.2:g.2807A>G, NM_001310136.1:c.121-377504T>C, NM_003321.4:c.817+13T>C, NR_039872.1:n.-399T>C, XM_011545928.2:c.817+13T>C, XM_017023619.1:c.817+13T>C
    2.

    rs1514176 [Homo sapiens]
      GATATTATGTAGCTGGGGTGCCTTG[C/T]TCTCATTGAAAACCTCTTCTCTTGC
      Chromosome:
      1:74525912
      Gene:
      FPGT-TNNI3K (GeneView) LOC105378803 (GeneView) TNNI3K (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.3880/1943
      HGVS:
      NC_000001.10:g.74991596G>A, NC_000001.11:g.74525912G>A, NG_032939.2:g.332660G>A, NM_001112808.2:c.2694-14322G>A, NM_015978.2:c.2352-14322G>A, XM_011542512.2:c.49+10892C>T, XM_017003081.1:c.49+10892C>T
      3.

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center