Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs11655470 [Homo sapiens]
    aattctgatagagccaacttacctt[C/T]ttcagagattgtactaatttacact
    Chromosome:
    17:45718067
    Gene:
    CRHR1-IT1-CRHR1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.3822/1914
    HGVS:
    NC_000017.10:g.43795433C>T, NC_000017.11:g.45718067C>T, NM_001256299.2:c.-493+87909C>T, NM_001303016.1:c.-185+45165C>T, NT_167251.1:g.1072010G>A, NT_167251.2:g.1070017G>A, NT_187663.1:g.420154C>T
    3.

    rs1042725 [Homo sapiens]
      TCAATACTACCTCTGAATGTTACAA[C/T]GAATTTACAGTCTAGTACTTATTAC
      Chromosome:
      12:65964567
      Gene:
      HMGA2 (GeneView)
      Functional Consequence:
      utr variant 3 prime
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.4175/2091
      HGVS:
      NC_000012.11:g.66358347C>T, NC_000012.12:g.65964567C>T, NG_016296.1:g.145108C>T, NM_003483.4:c.*1275C>T

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center