Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs4730775 [Homo sapiens]
    GTGATGGGCATTAGCAGACGGCGGA[C/T]GTGGCCGACTTCTTTCAGGCATCTG
    Chromosome:
    7:117277064
    Gene:
    WNT2 (GeneView)
    Functional Consequence:
    nc transcript variant,utr variant 3 prime
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.3235/1620
    HGVS:
    NC_000007.13:g.116917118C>T, NC_000007.14:g.117277064C>T, NM_003391.2:c.*1091G>A, NR_024047.1:n.2410G>A, XM_005250563.1:c.*1091G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center