Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 17

1.

rs9341247 [Homo sapiens]
    TGCTGGTGCGCGGCAGCGCGGACGG[A/C/T]GCCTTCCTCGACCCGAGGCCGCTGA
    Chromosome:
    2:38074825
    Gene:
    CYP1B1 (GeneView)
    Functional Consequence:
    synonymous codon
    Clinical significance:
    Likely benign
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0238/119
    HGVS:
    CM000664.2:g.38074825G>A, CM000664.2:g.38074825G>T, NC_000002.11:g.38301968G>A, NC_000002.11:g.38301968G>T, NC_000002.12:g.38074825G>A, NC_000002.12:g.38074825G>T, NG_008386.2:g.6277C>A, NG_008386.2:g.6277C>T, NM_000104.3:c.564C>A, NM_000104.3:c.564C>T, NP_000095.2:p.Gly188
    2.
    4.

    rs4986883 [Homo sapiens]
      TGCCTTCTGGCCTTGTAAGACCCTT[A/G]TTGCTGTCCTGGAGGGGCTGGGGAC
      Chromosome:
      15:74719876
      Gene:
      CYP1A1 (GeneView)
      Functional Consequence:
      utr variant 3 prime
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.0046/23
      HGVS:
      CM000677.2:g.74719876T>C, NC_000015.10:g.74719876T>C, NC_000015.9:g.75012217T>C, NG_008431.2:g.2335T>C, NM_000499.4:c.*613A>G, NM_001319216.1:c.*613A>G, NM_001319217.1:c.*613A>G
      5.

      rs4646903 [Homo sapiens]
        TTGTTTCACTGTAACCTCCACCTCC[C/T]GGGCTCACACGATTCTCCCACCTCA
        Chromosome:
        15:74719300
        Gene:
        CYP1A1 (GeneView)
        Functional Consequence:
        downstream variant 500B
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2931/1468
        HGVS:
        CM000677.2:g.74719300A>G, NC_000015.10:g.74719300A>G, NC_000015.9:g.75011641A>G, NC_000015.9:g.75011641A>T, NG_008431.2:g.1759A>G, NG_008431.2:g.1759A>T, NM_000499.4:c.*1189T>A, NM_000499.4:c.*1189T>C, NM_000499.4:c.*947+242T>C, NM_001319216.1:c.*1189T>A, NM_001319216.1:c.*1189T>C, NM_001319216.1:c.*947+242T>C, NM_001319217.1:c.*1189T>A, NM_001319217.1:c.*1189T>C, NM_001319217.1:c.*947+242T>C
        6.

        rs2234693 [Homo sapiens]
          TCATCTGAGTTCCAAATGTCCCAGC[C/T]GTTTTATGCTTTGTCTCTGTTTCCC
          Chromosome:
          6:151842200
          Gene:
          ESR1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.4463/2235
          HGVS:
          CM000668.2:g.151842200T>C, NC_000006.11:g.152163335T>C, NC_000006.12:g.151842200T>C, NG_008493.2:g.190510T>C, NM_000125.3:c.453-397T>C, NM_001122740.1:c.453-397T>C, NM_001122741.1:c.453-397T>C, NM_001122742.1:c.453-397T>C, NM_001291230.1:c.453-397T>C, NM_001291241.1:c.453-397T>C, NM_001328100.1:c.-67-397T>C, XR_001743222.1:n.823-397T>C, XR_001743223.1:n.823-397T>C
          7.

          rs1800440 [Homo sapiens]
            TTCTTGGACAAGGACGGCCTCATCA[A/C/G]CAAGGACCTGACCAGCAGAGTGATG
            Chromosome:
            2:38070996
            Gene:
            CYP1B1 (GeneView)
            Functional Consequence:
            missense
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            Likely benign
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            C=0.0996/499
            HGVS:
            CM000664.2:g.38070996T>C, CM000664.2:g.38070996T>G, NC_000002.11:g.38298139T>C, NC_000002.12:g.38070996T>C, NC_000002.12:g.38070996T>G, NG_008386.2:g.10106A>C, NG_008386.2:g.10106A>G, NM_000104.3:c.1358A>C, NM_000104.3:c.1358A>G, NP_000095.2:p.Asn453Ser, NP_000095.2:p.Asn453Thr
            10.

            rs1056836 [Homo sapiens]
              CCAGTGGTCTGTGAATCATGACCCA[C/G]TGAAGTGGCCTAACCCGGAGAACTT
              Chromosome:
              2:38071060
              Gene:
              CYP1B1 (GeneView)
              Functional Consequence:
              missense
              Clinical significance:
              drug-response
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.3852/1929
              HGVS:
              CM000664.2:g.38071060G>C, NC_000002.11:g.38298203C>G, NC_000002.12:g.38071060G, NC_000002.12:g.38071060G>C, NG_008386.2:g.10042C, NG_008386.2:g.10042C>G, NM_000104.3:c.1294C, NM_000104.3:c.1294C>G, NP_000095.2:p.Leu432, NP_000095.2:p.Leu432Val
              11.

              rs1056827 [Homo sapiens]
                GGGCTCGGCCTTCGCCGACCGGCCG[G/T]CCTTCGCCTCCTTCCGTGTGGTGTC
                Chromosome:
                2:38075034
                Gene:
                CYP1B1 (GeneView)
                Functional Consequence:
                missense
                Clinical significance:
                Benign
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency
                Global MAF:
                A=0.3624/1815
                HGVS:
                CM000664.2:g.38075034C>A, NC_000002.11:g.38302177C>A, NC_000002.12:g.38075034C>A, NG_008386.2:g.6068G>T, NM_000104.3:c.355G>T, NP_000095.2:p.Ala119Ser
                13.

                rs743572 [Homo sapiens]
                  GGTGCCGGCAGGCAAGATAGACAGC[A/G/T]GTGGAGTAGAAGAGCTGTGGCAACT
                  Chromosome:
                  10:102837395
                  Gene:
                  CYP17A1 (GeneView)
                  Functional Consequence:
                  utr variant 5 prime
                  Clinical significance:
                  Benign
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                  Global MAF:
                  G=0.4105/2056
                  HGVS:
                  CM000672.2:g.102837395A>G, CM000672.2:g.102837395A>T, NC_000010.10:g.104597152A>G, NC_000010.11:g.102837395A>G, NC_000010.11:g.102837395A>T, NG_007955.1:g.5139T>A, NG_007955.1:g.5139T>C, NG_055002.1:g.123A>G, NG_055002.1:g.123A>T, NM_000102.3:c.-34T>A, NM_000102.3:c.-34T>C
                  14.

                  rs605059 [Homo sapiens]
                    CCGAGCTCAGGGTCCCCCACCGCAC[A/C/G/T]GCGCCCGGCCTCGTCCTCTGCCCCA
                    Chromosome:
                    17:42554888
                    Gene:
                    HSD17B1 (GeneView) LOC108783654 (GeneView)
                    Functional Consequence:
                    downstream variant 500B,missense,nc transcript variant,synonymous codon,upstream variant 2KB
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.4774/2391
                    HGVS:
                    CM000679.2:g.42554888G>A, CM000679.2:g.42554888G>C, CM000679.2:g.42554888G>T, NC_000017.10:g.40706906G>A, NC_000017.10:g.40706906G>C, NC_000017.11:g.42554888G>A, NC_000017.11:g.42554888G>C, NC_000017.11:g.42554888G>T, NM_000413.3:c.937G>A, NM_000413.3:c.937G>C, NM_000413.3:c.937G>T, NM_001330219.2:c.940G>A, NM_001330219.2:c.940G>C, NM_001330219.2:c.940G>T, NP_000404.2:p.Gly313Arg, NP_000404.2:p.Gly313Cys, NP_000404.2:p.Gly313Ser, NP_001317148.1:p.Gly314Arg, NP_001317148.1:p.Gly314Cys, NP_001317148.1:p.Gly314Ser, NR_144397.1:n.1219G>A, NR_144397.1:n.1219G>C, NR_144397.1:n.1219G>T, NR_144402.1:n.-86C>A, NR_144402.1:n.-86C>G, NR_144402.1:n.-86C>T, XP_005257347.1:p.Ala342, XP_005257348.1:p.Ala341, XP_005257349.1:p.Gly344Arg, XP_005257349.1:p.Gly344Cys, XP_005257349.1:p.Gly344Ser, XP_005257350.1:p.Gly314Arg, XP_005257350.1:p.Gly314Ser, XP_006721920.1:p.Ala373, XP_006721921.1:p.Ala372, XP_006721922.1:p.Gly345Arg, XP_006721922.1:p.Gly345Cys, XP_006721922.1:p.Gly345Ser, XP_011523031.1:p.Ala342, XP_011523032.1:p.Ala341, XP_011523033.1:p.Gly314Arg, XP_011523033.1:p.Gly314Cys, XP_011523033.1:p.Gly314Ser, XR_243653.1:n.1219G>A, XR_243653.1:n.1219G>C, XR_934451.1:n.1219G>A, XR_934451.1:n.1219G>C, XR_934451.1:n.1219G>T
                    15.

                    rs10012 [Homo sapiens]
                      GCTGAGGCAACGGAGGCGGCAGCTC[C/G]GGTCCGCGCCCCCGGGCCCGTTTGC
                      Chromosome:
                      2:38075247
                      Gene:
                      CYP1B1 (GeneView)
                      Functional Consequence:
                      missense
                      Allele Origin:
                      G(germline)/C(germline)
                      Clinical significance:
                      Benign
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency
                      Global MAF:
                      C=0.3748/1877
                      HGVS:
                      CM000664.2:g.38075247G>C, NC_000002.11:g.38302390G>C, NC_000002.12:g.38075247G>C, NG_008386.2:g.5855C>G, NM_000104.3:c.142C>G, NP_000095.2:p.Arg48Gly
                      16.

                      rs4680 [Homo sapiens]
                        CCAGCGGATGGTGGATTTCGCTGGC[A/G]TGAAGGACAAGGTGTGCATGCCTGA
                        Chromosome:
                        22:19963748
                        Gene:
                        COMT (GeneView) MIR4761 (GeneView)
                        Functional Consequence:
                        missense,upstream variant 2KB
                        Allele Origin:
                        G(germline)/A(germline)
                        Clinical significance:
                        drug-response
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        A=0.3692/1849
                        HGVS:
                        CM000684.2:g.19963748G>A, NC_000022.10:g.19951271G>A, NC_000022.11:g.19963748G>A, NG_011526.1:g.27009G>A, NM_000754.3:c.472G>A, NM_001135161.1:c.472G>A, NM_001135162.1:c.472G>A, NM_007310.2:c.322G>A, NP_000745.1:p.Val158Met, NP_001128633.1:p.Val158Met, NP_001128634.1:p.Val158Met, NP_009294.1:p.Val108Met, NR_039918.1:n.-5G>A, XP_005261286.1:p.Val158Met, XP_011528188.1:p.Val196Met, XP_016884083.1:p.Val158Met, XP_016884084.1:p.Val158Met
                        17.

                        rs1695 [Homo sapiens]
                          CGTGGAGGACCTCCGCTGCAAATAC[A/G]TCTCCCTCATCTACACCAACTATGT
                          Chromosome:
                          11:67585218
                          Gene:
                          GSTP1 (GeneView)
                          Functional Consequence:
                          missense
                          Clinical significance:
                          drug-response
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          G=0.3526/1766
                          HGVS:
                          CM000673.2:g.67585218A>G, NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XP_005274015.1:p.Ile105Val

                          Display Settings:

                          Format
                          Items per page
                          Sort by

                          Send to:

                          Choose Destination

                          Supplemental Content

                          Find related data

                          Recent activity

                          Your browsing activity is empty.

                          Activity recording is turned off.

                          Turn recording back on

                          See more...
                          Support Center