Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs7766029 [Homo sapiens]
    TACATTGTTGTAGCCTTTTGCAGGT[C/T]TCAAAGCTCTTCAAAACACTTTATA
    Chromosome:
    6:88137716
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.3864/1935
    HGVS:
    NC_000006.11:g.88847435T>C, NC_000006.12:g.88137716T>C
    3.

    rs1360780 [Homo sapiens]
      GAAGGCTTTCACATAAGCAAAGTTA[C/T]ACAAAACAAAAATTCTTACTTGCTA
      Chromosome:
      6:35639794
      Gene:
      FKBP5 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3273/1639
      HGVS:
      NC_000006.11:g.35607571T>C, NC_000006.12:g.35639794T>C, NG_012645.2:g.93790A>G, NM_001145775.2:c.106-2636A>G, NM_001145776.1:c.106-2636A>G, NM_001145777.1:c.106-2636A>G, NM_004117.3:c.106-2636A>G

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center