Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 17

2.

rs11536889 [Homo sapiens]
    ATGCTCCTTGACCACATTTTGGGAA[C/G]AGTGGATGTTATCATTGAGAAAACA
    Chromosome:
    9:117715853
    Gene:
    TLR4 (GeneView)
    Functional Consequence:
    utr variant 3 prime
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1378/690
    HGVS:
    NC_000009.11:g.120478131G>C, NC_000009.12:g.117715853G>C, NG_011475.1:g.16672G>C, NM_003266.3:c.*1205G>C, NM_138554.3:c.*1205G>C, NM_138554.4:c.*1205G>C, NM_138557.2:c.*1205G>C, XM_005252182.1:c.*1205G>C
    7.

    rs5030728 [Homo sapiens]
      CTATCCATATTATCTGTACCAATCA[A/G]ATGTATAATCACAATTTTGTGTGAC
      Chromosome:
      9:117712004
      Gene:
      TLR4 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1621/812
      HGVS:
      NC_000009.11:g.120474282G>A, NC_000009.12:g.117712004G>A, NG_011475.1:g.12823G>A, NM_003266.3:c.141-385G>A, NM_138554.3:c.261-385G>A, NM_138554.4:c.261-385G>A, NM_138557.2:c.-340-385G>A, XM_005252182.1:c.255-385G>A
      8.

      rs4988457 [Homo sapiens]
        GGGGTCCAGATACTGGGCATCTCCT[C/G]CTAGCTGTGCACTGTCCAGCCTGGG
        Chromosome:
        3:38140645
        Gene:
        MYD88 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.0419/210
        HGVS:
        NC_000003.11:g.38182136C>G, NC_000003.12:g.38140645C>G, NG_016964.1:g.7168C>G, NG_023225.1:g.1598G>C, NM_001172566.1:c.368-112C>G, NM_001172567.1:c.707+53C>G, NM_001172568.1:c.548+77C>G, NM_001172569.1:c.503-112C>G, NM_002468.4:c.683+77C>G, XM_005265172.1:c.664+96C>G, XM_006713170.1:c.529+96C>G
        9.

        rs4986790 [Homo sapiens]
          GCATACTTAGACTACTACCTCGATG[A/G]TATTATTGACTTATTTAATTGTTTG
          Chromosome:
          9:117713024
          Gene:
          TLR4 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          Benign
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.0599/300
          HGVS:
          NC_000009.11:g.120475302A>G, NC_000009.12:g.117713024A>G, NG_011475.1:g.13843A>G, NM_003266.3:c.776A>G, NM_138554.3:c.896A>G, NM_138554.4:c.896A>G, NM_138557.2:c.296A>G, NP_003257.1:p.Asp259Gly, NP_612564.1:p.Asp299Gly, NP_612567.1:p.Asp99Gly, XM_005252182.1:c.890A>G, XP_005252239.1:p.Asp297Gly
          14.

          rs1927911 [Homo sapiens]
            CAGATTTTGACAACTGCATTCTTTT[C/T]CTTGGCTCATTGACCCTTGAGCAAA
            Chromosome:
            9:117707776
            Gene:
            TLR4 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.4002/2004
            HGVS:
            NC_000009.11:g.120470054A>G, NC_000009.12:g.117707776A>G, NG_011475.1:g.8595A>G, NM_003266.3:c.-147-423A>G, NM_138554.3:c.94-787A>G, NM_138554.4:c.94-787A>G, NM_138557.2:c.-341+3211A>G, XM_005252182.1:c.88-787A>G
            16.

            rs1039559 [Homo sapiens]
              agccttttttctcccacatatcttt[C/T]tccatatatctttgcatatttccca
              Chromosome:
              4:38829975
              Gene:
              TLR6 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              G=0.3323/1664
              HGVS:
              NC_000004.11:g.38831596G>A, NC_000004.12:g.38829975G>A, NG_028087.1:g.31843C>T, NM_006068.3:c.-64-438C>T, NM_006068.4:c.-64-438C>T, XM_005262636.1:c.-64-438C>T, XM_005262637.1:c.-64-438C>T, XM_005262637.4:c.-64-438C>T, XM_011513612.2:c.-64-438C>T, XM_011513613.2:c.-64-438C>T, XM_011513614.2:c.-64-438C>T
              17.

              rs7744 [Homo sapiens]
                CAATGTACCAGTATTTATACCTCTA[A/G]TGAAGCACAGAGAGAGGAAGAGAGC
                Chromosome:
                3:38142530
                Gene:
                MYD88 (GeneView)
                Functional Consequence:
                utr variant 3 prime
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.1424/713
                HGVS:
                NC_000003.11:g.38184021A>G, NC_000003.12:g.38142530A>G, NG_016964.1:g.9053A>G, NM_001172566.1:c.*1378A>G, NM_001172567.1:c.*1244A>G, NM_001172568.1:c.*1244A>G, NM_001172569.1:c.*1378A>G, NM_002468.4:c.*1244A>G, XM_005265172.1:c.*1378A>G, XM_006713170.1:c.*1378A>G

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center