Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

2.

rs2287019 [Homo sapiens]
    TGAGGAGCATTGGTAAGGGTGAATG[C/T]GGAGGTGGGCCCCAGCCCACCTGGG
    Chromosome:
    19:45698914
    Gene:
    QPCTL (GeneView)
    Functional Consequence:
    downstream variant 500B,intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1540/771
    HGVS:
    NC_000019.10:g.45698914C>T, NC_000019.9:g.46202172C>T, NM_001163377.1:c.604+14C>T, NM_017659.3:c.886+14C>T, XM_011527048.2:c.*327C>T, XM_017026900.1:c.*127C>T, XR_001753711.1:n.1086+215C>T

    Display Settings:

    Format
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center