Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.
2.
3.

rs3019885 [Homo sapiens]
    AACAAAAGACTGGGAATACAAGGAC[G/T]GAGCAGCAGAGATGTTCAGTGGGAA
    Chromosome:
    8:117013406
    Gene:
    SLC30A8 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.3544/1775
    HGVS:
    NC_000008.10:g.118025645T>G, NC_000008.11:g.117013406T>G, NG_016991.1:g.68134T>G, NM_001172811.1:c.-107+62287T>G, NM_001172813.1:c.-274+6293T>G, NM_001172815.2:c.-265-25813T>G, XM_005250809.1:c.-107+62287T>G
    4.

    rs2938864 [Homo sapiens]
      TGGGAGATCCTTAGTGGAAAATCTG[A/G]TCCTTTGAGGACGTGCTTCCACTTA
      Chromosome:
      8:117000026
      Gene:
      SLC30A8 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.3762/1884
      HGVS:
      NC_000008.10:g.118012265G>A, NC_000008.11:g.117000026G>A, NG_016991.1:g.54754G>A, NM_001172811.1:c.-107+48907G>A, NM_001172813.1:c.-396-6965G>A, NM_001172815.2:c.-265-39193G>A, XM_005250809.1:c.-107+48907G>A
      5.

      rs1466535 [Homo sapiens]
        GGAAGCAGGGTCCATGGCAGAGAAA[C/T]TCCAATGATAAAGAAAAACTCCTTC
        Chromosome:
        12:57140687
        Gene:
        LRP1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        A=0.2772/1388
        HGVS:
        NC_000012.11:g.57534470G>A, NC_000012.12:g.57140687G>A, NG_016444.1:g.17189G>A, NM_002332.2:c.191-687G>A, XM_017019303.1:c.191-687G>A
        6.

        rs1466525 [Homo sapiens]
          GAAGGAAGGAAGGAAGACTACTTCC[A/G]TAATGGTTGGATTTACCTAAGATTT
          Chromosome:
          8:53867649
          Gene:
          RGS20 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1508/755
          HGVS:
          NC_000008.10:g.54780209C>T, NC_000008.11:g.53867649C>T, NM_001286673.1:c.165+15585C>T, NM_001286674.1:c.35+15585C>T, NM_001286675.1:c.35+15585C>T, NM_170587.3:c.166-11609C>T, XM_005251323.1:c.165+15585C>T
          7.

          rs1333049 [Homo sapiens]
            CATACTAACCATATGATCAACAGTT[C/G]AAAAGCAGCCACTCGCAGAGGTAAG
            Chromosome:
            9:22125504
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            C=0.4181/2094
            HGVS:
            NC_000009.11:g.22125503G>C, NC_000009.12:g.22125504G>C

            Display Settings:

            Format
            Items per page
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center