Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs7997012 [Homo sapiens]
    TGCCATTATCTTCAAAGACTTAATT[A/G]ACAATATTTGTCACTTGCCTATGCA
    Chromosome:
    13:46837850
    Gene:
    HTR2A (GeneView)
    Functional Consequence:
    intron variant
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2728/1366
    HGVS:
    NC_000013.10:g.47411985A>G, NC_000013.11:g.46837850A>G, NG_013011.1:g.64185T>C, NM_000621.4:c.614-2211T>C, NM_001165947.2:c.362-2211T>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center