Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs4939827 [Homo sapiens]
    TCACAGCCTCATCCAAAAGAGGAAA[C/T]AGGACCCCAGAGCTCCCTCAGACTC
    Chromosome:
    18:48927093
    Gene:
    SMAD7 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.3532/1769
    HGVS:
    NC_000018.10:g.48927093T>C, NC_000018.9:g.46453463T>C, NG_023330.1:g.28619A>G, NM_001190821.1:c.740-5183A>G, NM_001190822.1:c.98-5183A>G, NM_001190823.1:c.179-5183A>G, NM_005904.3:c.743-5183A>G
    2.

    rs4464148 [Homo sapiens]
      GGGGGAACAGACAGAGAAGGATGAA[C/T]GTGAAAAGGAAACACCCTGGTAACT
      Chromosome:
      18:48932662
      Gene:
      SMAD7 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1595/799
      HGVS:
      NC_000018.10:g.48932662T>C, NC_000018.9:g.46459032T>C, NG_023330.1:g.23050A>G, NM_001190821.1:c.739+9819A>G, NM_001190822.1:c.97+9819A>G, NM_001190823.1:c.178+9819A>G, NM_005904.3:c.742+9819A>G

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center