Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 29

3.

rs17249754 [Homo sapiens]
    TCCAAGACCTTCTTAAATTACTCCA[A/G]CTCTTTCCAGGGTCCTCAAGTCTGC
    Chromosome:
    12:89666809
    Gene:
    ATP2B1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2095/1049
    HGVS:
    NC_000012.11:g.90060586G>A, NC_000012.12:g.89666809G>A, XM_005268918.1:c.-221-10702C>T, XM_005268919.1:c.-221-10702C>T, XM_005268920.1:c.-221-10702C>T, XM_005268921.1:c.-221-10702C>T, XM_011538407.2:c.-221-10702C>T
    6.

    rs13082711 [Homo sapiens]
      AGATCTGTTTAAAAACAGCTCCCTA[C/T]GATGGGGGCCAGTCTGGATGTCCTT
      Chromosome:
      3:27496418
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.1196/599
      HGVS:
      NC_000003.11:g.27537909T>C, NC_000003.12:g.27496418T>C
      7.

      rs12940887 [Homo sapiens]
        aacagtaacatcaaagatcatttat[C/T]acagatcactgttaacagatatcag
        Chromosome:
        17:49325445
        Gene:
        ZNF652 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1849/926
        HGVS:
        NC_000017.10:g.47402807C>T, NC_000017.11:g.49325445C>T, NM_001145365.1:c.-258-7462G>A, NM_014897.2:c.-258-7462G>A, NR_135579.1:n.207-2937G>A
        8.

        rs11953630 [Homo sapiens]
          CCTGGAACAGAATGATCCTCCCCTG[A/C/T]GGTTCCATGCAATGCTTTATTTGTG
          Chromosome:
          5:158418394
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          HGVS:
          NC_000005.10:g.158418394C>A, NC_000005.10:g.158418394C>T, NC_000005.9:g.157845402C>T
          9.

          rs11191548 [Homo sapiens]
            ATTAAATAGTTTCCATAACATGGAA[C/T]GTGGGTAAGGTTCCTACCCTAATAC
            Chromosome:
            10:103086421
            Gene:
            CNNM2 (GeneView)
            Functional Consequence:
            nc transcript variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.1524/763
            HGVS:
            NC_000010.10:g.104846178T>C, NC_000010.11:g.103086421T>C, NG_042272.1:g.111886A>G, XR_001747118.1:n.12122T>C, XR_001747119.1:n.12056T>C, XR_001747121.1:n.12086T>C
            10.

            rs10850411 [Homo sapiens]
              TCAAATGTCTGCTACACATTAGGCA[C/T]TGTGATAGGCAGCAGATACACAAGA
              Chromosome:
              12:114949991
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.4698/2353
              HGVS:
              NC_000012.11:g.115387796T>C, NC_000012.12:g.114949991T>C
              11.

              rs7129220 [Homo sapiens]
                aggattgagctgccaccctcttatc[A/G]ggacactagatttatggctgtggtc
                Chromosome:
                11:10328991
                Gene:
                CAND1.11 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.0579/290
                HGVS:
                NC_000011.10:g.10328991G>A, NC_000011.9:g.10350538G>A, NR_103765.1:n.362-1579G>A
                13.

                rs4590817 [Homo sapiens]
                  CACTGCTCACTAACCTTGAATGAAT[C/G]TACTCTGCATAATTGACACAAAAAA
                  Chromosome:
                  10:61707795
                  Gene:
                  C10orf107 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  C=0.1098/550
                  HGVS:
                  NC_000010.10:g.63467553G>C, NC_000010.11:g.61707795G>C, NM_173554.2:c.288+17174G>C, XM_005269598.1:c.414+17174G>C, XM_005269598.3:c.414+17174G>C, XM_005269599.1:c.414+17174G>C, XM_005269599.4:c.414+17174G>C, XM_005269600.1:c.288+17174G>C, XM_005269600.4:c.288+17174G>C, XM_005269601.1:c.414+17174G>C, XM_006717690.3:c.552+17174G>C
                  14.

                  rs4373814 [Homo sapiens]
                    GTGGGCTGCATATTGTCCTTCTCCG[C/G/T]TGTTTATAGCTCAGTACTCTAGAGA
                    Chromosome:
                    10:18131043
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency
                    Global MAF:
                    G=0.4878/2443
                    HGVS:
                    NC_000010.10:g.18419972G>C, NC_000010.11:g.18131043G>C, NC_000010.11:g.18131043G>T
                    18.

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center