Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 37

2.

rs17477177 [Homo sapiens]
    CTTGGCATTAACTTATTTTGAGTTT[C/T]AATTGAAAACACCCAGATAAAAGTG
    Chromosome:
    7:106771412
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1677/840
    HGVS:
    NC_000007.13:g.106411858T>C, NC_000007.14:g.106771412T>C
    4.

    rs17249754 [Homo sapiens]
      TCCAAGACCTTCTTAAATTACTCCA[A/G]CTCTTTCCAGGGTCCTCAAGTCTGC
      Chromosome:
      12:89666809
      Gene:
      ATP2B1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2095/1049
      HGVS:
      NC_000012.11:g.90060586G>A, NC_000012.12:g.89666809G>A, XM_005268918.1:c.-221-10702C>T, XM_005268919.1:c.-221-10702C>T, XM_005268920.1:c.-221-10702C>T, XM_005268921.1:c.-221-10702C>T, XM_011538407.2:c.-221-10702C>T
      5.

      rs16849225 [Homo sapiens]
        AAGAAATGGAAACAAGCGAGCCCCA[C/T]AGAGAGTTCGGATTAATGTGCAGTA
        Chromosome:
        2:164050310
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2334/1169
        HGVS:
        NC_000002.11:g.164906820C>T, NC_000002.12:g.164050310C>T
        8.

        rs13082711 [Homo sapiens]
          AGATCTGTTTAAAAACAGCTCCCTA[C/T]GATGGGGGCCAGTCTGGATGTCCTT
          Chromosome:
          3:27496418
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1196/599
          HGVS:
          NC_000003.11:g.27537909T>C, NC_000003.12:g.27496418T>C
          9.

          rs13002573 [Homo sapiens]
            TACCTGAATTGATTATTGTAAATGC[A/G]GTTTGAAGAAATTTCAAATAGAGAG
            Chromosome:
            2:164058698
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.2268/1136
            HGVS:
            NC_000002.11:g.164915208A>G, NC_000002.12:g.164058698A>G
            10.

            rs12940887 [Homo sapiens]
              aacagtaacatcaaagatcatttat[C/T]acagatcactgttaacagatatcag
              Chromosome:
              17:49325445
              Gene:
              ZNF652 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.1849/926
              HGVS:
              NC_000017.10:g.47402807C>T, NC_000017.11:g.49325445C>T, NM_001145365.1:c.-258-7462G>A, NM_014897.2:c.-258-7462G>A, NR_135579.1:n.207-2937G>A
              12.

              rs11222084 [Homo sapiens]
                CTGAGTCCCTGGGCTGCAGCTGTTG[A/T]ATTTCCAGACACAAACAAGTATGCG
                Chromosome:
                11:130403335
                Gene:
                LOC646383 (GeneView)
                Functional Consequence:
                intron variant,nc transcript variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2139/1071
                HGVS:
                NC_000011.10:g.130403335A>T, NC_000011.9:g.130273230A>T, XR_001748445.1:n.1908A>T, XR_948178.2:n.2081A>T, XR_948179.1:n.2002A>T, XR_948180.1:n.2002A>T, XR_948181.2:n.568A>T, XR_948182.2:n.2159A>T, XR_948183.2:n.455+9536A>T, XR_948184.2:n.490A>T, XR_948185.2:n.409A>T, XR_948187.2:n.455+9536A>T, XR_948188.1:n.325A>T, XR_948189.2:n.385A>T
                13.

                rs11191593 [Homo sapiens]
                  TAAAGTAAAGGAGTGATATACAAAA[C/T]AAAACAAACAGCAACTGCATATACA
                  Chromosome:
                  10:103179458
                  Gene:
                  NT5C2 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.1569/786
                  HGVS:
                  NC_000010.10:g.104939215T>C, NC_000010.11:g.103179458T>C, NG_042272.1:g.18849A>G, NM_001134373.2:c.-24-4476A>G, NM_012229.4:c.-25+1773A>G, XM_005269632.1:c.-24-4476A>G, XM_005269632.4:c.-24-4476A>G, XM_005269633.1:c.-25+1773A>G, XM_005269633.4:c.-25+1773A>G, XM_005269634.1:c.-25+1727A>G, XM_005269634.4:c.-25+1727A>G, XM_005269636.1:c.-25+1727A>G, XM_005269636.4:c.-25+1727A>G, XM_005269640.1:c.-659+1773A>G, XM_005269640.4:c.-659+1773A>G, XM_005269641.1:c.-658-4476A>G, XM_005269641.4:c.-658-4476A>G, XM_005269643.1:c.-523-4476A>G, XM_005269643.4:c.-523-4476A>G, XM_005269644.1:c.-683+1773A>G, XM_005269644.4:c.-683+1773A>G, XM_005269645.1:c.-682-4476A>G, XM_005269645.4:c.-682-4476A>G, XM_005269646.1:c.-608-4476A>G, XM_005269646.4:c.-608-4476A>G, XM_006717721.3:c.-585+1773A>G, XM_006717723.3:c.-479-4476A>G, XM_011539537.2:c.-25+1727A>G, XM_017015948.1:c.-242+1727A>G, XM_017015949.1:c.-850-4476A>G, XM_017015950.1:c.-566-4476A>G, XM_017015951.1:c.-492-4476A>G, XM_017015952.1:c.-789-4476A>G, XM_017015955.1:c.-810-4476A>G, XM_017015957.1:c.-874-4476A>G, XM_017015958.1:c.-896+1773A>G, XM_017015959.1:c.-584-4476A>G, XM_017015962.1:c.-776-4476A>G, XM_017015963.1:c.-737+1727A>G, XM_017015964.1:c.-716+1727A>G, XM_017015965.1:c.-715-4476A>G, XM_017015966.1:c.-736-4476A>G, XM_017015967.1:c.-671-4476A>G, XM_017015968.1:c.-567+1773A>G, XM_017015969.1:c.-758-4476A>G, XM_017015971.1:c.-431-4476A>G, XM_017015972.1:c.-840-4476A>G, XM_017015973.1:c.-864-4476A>G, XM_017015974.1:c.-767+1773A>G, XM_017015975.1:c.-705-4476A>G
                  14.

                  rs11191548 [Homo sapiens]
                    ATTAAATAGTTTCCATAACATGGAA[C/T]GTGGGTAAGGTTCCTACCCTAATAC
                    Chromosome:
                    10:103086421
                    Gene:
                    CNNM2 (GeneView)
                    Functional Consequence:
                    nc transcript variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.1524/763
                    HGVS:
                    NC_000010.10:g.104846178T>C, NC_000010.11:g.103086421T>C, NG_042272.1:g.111886A>G, XR_001747118.1:n.12122T>C, XR_001747119.1:n.12056T>C, XR_001747121.1:n.12086T>C
                    16.

                    rs9313772 [Homo sapiens]
                      TCTACCAAAATAAATTTGTGAGTGA[C/T]AGTCTATAAAACAGTCCCTATGAGT
                      Chromosome:
                      5:158377449
                      Gene:
                      LOC101927697 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2634/1319
                      HGVS:
                      NC_000005.10:g.158377449C>T, NC_000005.9:g.157804457C>T, NR_109888.1:n.129-7839G>A
                      17.

                      rs7129220 [Homo sapiens]
                        aggattgagctgccaccctcttatc[A/G]ggacactagatttatggctgtggtc
                        Chromosome:
                        11:10328991
                        Gene:
                        CAND1.11 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.0579/290
                        HGVS:
                        NC_000011.10:g.10328991G>A, NC_000011.9:g.10350538G>A, NR_103765.1:n.362-1579G>A
                        19.

                        rs4590817 [Homo sapiens]
                          CACTGCTCACTAACCTTGAATGAAT[C/G]TACTCTGCATAATTGACACAAAAAA
                          Chromosome:
                          10:61707795
                          Gene:
                          C10orf107 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          C=0.1098/550
                          HGVS:
                          NC_000010.10:g.63467553G>C, NC_000010.11:g.61707795G>C, NM_173554.2:c.288+17174G>C, XM_005269598.1:c.414+17174G>C, XM_005269598.3:c.414+17174G>C, XM_005269599.1:c.414+17174G>C, XM_005269599.4:c.414+17174G>C, XM_005269600.1:c.288+17174G>C, XM_005269600.4:c.288+17174G>C, XM_005269601.1:c.414+17174G>C, XM_006717690.3:c.552+17174G>C

                          Display Settings:

                          Format
                          Items per page
                          Sort by

                          Send to:

                          Choose Destination

                          Supplemental Content

                          Find related data

                          Recent activity

                          Your browsing activity is empty.

                          Activity recording is turned off.

                          Turn recording back on

                          See more...
                          Support Center