Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs878960 [Homo sapiens]
    GCCAGGTCCCCACTCATGAGTGTAT[A/G]AGAGTGTATAATCCTATATAGTTTT
    Chromosome:
    15:26683789
    Gene:
    GABRB3 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    T=0.4902/2455
    HGVS:
    NC_000015.10:g.26683789C>T, NC_000015.9:g.26928936C>T, NG_012836.1:g.94992G>A, NM_000814.5:c.241-62255G>A, NM_001191320.1:c.-16+32825G>A, NM_001278631.1:c.-111-41261G>A, NM_021912.4:c.241-62255G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center