Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 34

1.
2.
3.

rs10204837 [Homo sapiens]
    AGTGGGGGAGGTTTCAAACCATAGA[A/C]CCAGTCTAATTTGATTATGCACAGT
    Chromosome:
    2:102361270
    Gene:
    IL18R1 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3610/1808
    HGVS:
    NC_000002.11:g.102977730C>A, NC_000002.12:g.102361270C>A, NM_001282399.1:c.-306-1363C>A, NM_003855.3:c.-28-1363C>A, XM_005264039.1:c.-1391C>A, XM_005264039.3:c.-1391C>A, XM_005264040.1:c.-1391C>A, XM_005264040.3:c.-1391C>A, XM_011512099.1:c.-1391C>A, XM_017005181.1:c.-1913C>A, XM_017005182.1:c.-531-1363C>A, XM_017005183.1:c.-531-1363C>A, XM_017005184.1:c.-365-1363C>A, XR_923054.2:n.-1363C>A
    4.
    5.
    6.

    rs8178561 [Homo sapiens]
      CCCACATCTAGAACTCCCAGACCCT[A/G]GACTTAGCCACCAGAGAGCTACATT
      Chromosome:
      21:33296492
      Gene:
      IL10RB (GeneView)
      Functional Consequence:
      utr variant 3 prime
      Clinical significance:
      Likely benign
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0597/299
      HGVS:
      NC_000021.8:g.34668797G>A, NC_000021.9:g.33296492G>A, NG_012089.1:g.35126G>A, NM_000628.3:c.*135G>A, NM_000628.4:c.*135G>A, XM_005260970.1:c.*135G>A, XM_005260971.1:c.*135G>A
      7.
      8.
      9.
      10.

      rs6710885 [Homo sapiens]
        AGTTAACTTGTCAGTTTGCTGAGCC[A/G]TCTCCTGATAACTTTGTCTCTTGGT
        Chromosome:
        2:102361077
        Gene:
        IL18R1 (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.3291/1648
        HGVS:
        NC_000002.11:g.102977537A>G, NC_000002.12:g.102361077A>G, NM_001282399.1:c.-306-1556A>G, NM_003855.3:c.-28-1556A>G, XM_005264039.1:c.-1584A>G, XM_005264039.3:c.-1584A>G, XM_005264040.1:c.-1584A>G, XM_005264040.3:c.-1584A>G, XM_011512099.1:c.-1584A>G, XM_017005181.1:c.-2106A>G, XM_017005182.1:c.-531-1556A>G, XM_017005183.1:c.-531-1556A>G, XM_017005184.1:c.-365-1556A>G, XR_923054.2:n.-1556A>G
        11.
        12.

        rs5744280 [Homo sapiens]
          TGCCTGTTCTACCTATCCACACTCT[C/T]GCTTTCAACTGTAACTTTCTTTTTT
          Chromosome:
          11:112145791
          Gene:
          IL18 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.4259/2133
          HGVS:
          NC_000011.10:g.112145791G>A, NC_000011.9:g.112016514G>A, NG_028143.1:g.23327C>T, NM_001243211.1:c.349-1974C>T, NM_001562.3:c.361-1974C>T, XM_005271612.1:c.-25+11437G>A, XM_011542805.1:c.349-1974C>T, XM_011542806.2:c.361-1974C>T
          13.

          rs5744229 [Homo sapiens]
            GGAAAGTCAGCCATGGCAATTAGAG[A/G]TAAATAAGCTAGAAAGCAATTGAGA
            Chromosome:
            11:112163854
            Gene:
            IL18 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.0274/137
            HGVS:
            NC_000011.10:g.112163854C>T, NC_000011.9:g.112034577C>T, NG_028143.1:g.5264G>A, NM_001243211.1:c.-9+52G>A, NM_001562.3:c.-9+52G>A, XM_005271612.1:c.-24-5391C>T, XM_011542805.1:c.-30+52G>A, XM_011542806.2:c.-30+52G>A
            14.
            15.

            rs3882891 [Homo sapiens]
              AAGCTGTTTGATGTATAGGGGAAAA[A/C]TAGAGGCCTGGAACTGAATATGCAT
              Chromosome:
              11:112144038
              Gene:
              IL18 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.4615/2311
              HGVS:
              NC_000011.10:g.112144038G>T, NC_000011.9:g.112014761G>T, NG_028143.1:g.25080C>A, NM_001243211.1:c.349-221C>A, NM_001562.3:c.361-221C>A, XM_005271612.1:c.-25+9684G>T, XM_011542805.1:c.349-221C>A, XM_011542806.2:c.361-221C>A
              17.
              18.

              rs3755276 [Homo sapiens]
                CATAGGTGTGTATGCATGTGTTCGC[A/G]TGTGTCTGTGGCTGCCCATATGAGT
                Chromosome:
                2:102361999
                Gene:
                IL18R1 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.3610/1808
                HGVS:
                NC_000002.11:g.102978459C>T, NC_000002.12:g.102361999C>T, NM_001282399.1:c.-306-634C>T, NM_003855.3:c.-28-634C>T, XM_005264039.1:c.-662C>T, XM_005264039.3:c.-662C>T, XM_005264040.1:c.-662C>T, XM_005264040.3:c.-662C>T, XM_011512099.1:c.-662C>T, XM_017005181.1:c.-1184C>T, XM_017005182.1:c.-531-634C>T, XM_017005183.1:c.-531-634C>T, XM_017005184.1:c.-365-634C>T, XR_923054.2:n.-634C>T
                19.
                20.

                rs2287037 [Homo sapiens]
                  AACAAAAGTGTGCCTATCTTATGAA[A/G]GTTTAAAAATCTTCTGGCACACAGA
                  Chromosome:
                  2:102362568
                  Gene:
                  IL18R1 (GeneView)
                  Functional Consequence:
                  intron variant,upstream variant 2KB
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.3293/1649
                  HGVS:
                  NC_000002.11:g.102979028C>T, NC_000002.12:g.102362568C>T, NM_001282399.1:c.-306-65C>T, NM_003855.3:c.-28-65C>T, XM_005264039.1:c.-93C>T, XM_005264039.3:c.-93C>T, XM_005264040.1:c.-93C>T, XM_005264040.3:c.-93C>T, XM_011512099.1:c.-93C>T, XM_017005181.1:c.-615C>T, XM_017005182.1:c.-531-65C>T, XM_017005183.1:c.-531-65C>T, XM_017005184.1:c.-365-65C>T, XR_923054.2:n.-65C>T

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Support Center