Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 17

1.

rs16880395 [Homo sapiens]
    TTTCCATATAACTCTGGTGTTGACC[C/T]AGCGGGTAGCATGAGATGAAATAAA
    Chromosome:
    4:28238041
    Gene:
    LOC105374557 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1801/902
    HGVS:
    NC_000004.11:g.28239663C>T, NC_000004.12:g.28238041C>T, XR_001741640.1:n.239+22893C>T
    3.

    rs12517578 [Homo sapiens]
      GGATTTTTTTACCCAGAGAATTTGC[A/C/G]AGTTTACTTGTGGTTTGTTAGGAAA
      Chromosome:
      5:106645130
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3209/1607
      HGVS:
      NC_000005.10:g.106645130C>A, NC_000005.10:g.106645130C>G, NC_000005.9:g.105980831C>G
      4.

      rs12296050 [Homo sapiens]
        AAATGCACTGTCTCTCCTGGGCTCC[C/T]AACCTTTCACAGGCCACAGGCCCAT
        Chromosome:
        11:2468112
        Gene:
        KCNQ1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3990/1998
        HGVS:
        NC_000011.10:g.2468112C>T, NC_000011.9:g.2489342C>T, NG_008935.1:g.28122C>T, NM_000218.2:c.386+22628C>T, NM_181798.1:c.5+6398C>T, NR_040711.2:n.279+6398C>T
        5.

        rs12143842 [Homo sapiens]
          TAGCACCCAGGGTCACATCCCAGTT[C/T]AAAAATATCCCATGGAGTGCAGTCA
          Chromosome:
          1:162064100
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.2688/1346
          HGVS:
          NC_000001.10:g.162033890C>T, NC_000001.11:g.162064100C>T
          6.

          rs11970286 [Homo sapiens]
            ctgaggccaaaggcatgagaactag[C/T]gaatgggaggaggagtgaaggtagg
            Chromosome:
            6:118359211
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.2927/1466
            HGVS:
            NC_000006.11:g.118680374C>T, NC_000006.12:g.118359211C>T
            7.

            rs11626637 [Homo sapiens]
              TGTTTGGTCAATTCAGATAAATCCA[A/G]AGCAAACTCTTGAGTAGATACGTAC
              Chromosome:
              14:46253459
              Gene:
              LINC00871 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.0333/167
              HGVS:
              NC_000014.8:g.46722662A>G, NC_000014.9:g.46253459A>G, NR_102701.1:n.232+41655A>G, NR_102702.1:n.232+41655A>G
              8.

              rs11153730 [Homo sapiens]
                TTAACCTCTATCACTCTTAATTTCA[C/T]CATCTGTAATGCAGGGAAAATTAAA
                Chromosome:
                6:118346359
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.3269/1637
                HGVS:
                NC_000006.11:g.118667522T>C, NC_000006.12:g.118346359T>C
                9.

                rs7218928 [Homo sapiens]
                  AAGAAAAGCACATTGTATGCAGGGT[A/G]TTAATAAAGTCATGGGGTCTTTGCT
                  Chromosome:
                  17:36906671
                  Gene:
                  LOC102723471 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.4519/2263
                  HGVS:
                  NC_000017.10:g.35263956A>G, NC_000017.11:g.36906671G>A, NR_135669.1:n.942+324C>T, NR_135669.1:n.942+324T>C, NR_135670.1:n.643+324C>T, NR_135670.1:n.643+324T>C, NR_135671.1:n.98+29893C>T, NR_135671.1:n.98+29907T>C, NT_187614.1:g.1143021A, NT_187614.1:g.1143021A>G
                  10.

                  rs6507566 [Homo sapiens]
                    tggctgcaacccactatcctagagg[G/T]aatgtcaatgctgaaaaccccagag
                    Chromosome:
                    18:44105760
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.2478/1241
                    HGVS:
                    NC_000018.10:g.44105760T>G, NC_000018.9:g.41685725T>G
                    11.

                    rs4687718 [Homo sapiens]
                      ggataagagcAAAATGCTAAGAAAa[A/G]ctggtgaatggataaacaaaatgca
                      Chromosome:
                      3:53248287
                      Gene:
                      TKT (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.2416/1210
                      HGVS:
                      NC_000003.11:g.53282303A>G, NC_000003.12:g.53248287A>G, NG_027815.1:g.12828T>C, NM_001064.3:c.108-6045T>C, NM_001135055.2:c.108-6045T>C, NM_001258028.1:c.108-6045T>C, NR_047580.1:n.280-6045T>C, NW_004775426.1:g.97242A>G, XM_011534054.1:c.108-6045T>C, XM_011534055.1:c.-516-6045T>C
                      12.

                      rs4665058 [Homo sapiens]
                        TACGCTCTTAAAAACAAAATAGCTT[A/C]ACTGTTCCAACTTACTTTAATTTTC
                        Chromosome:
                        2:159333698
                        Gene:
                        BAZ2B (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.1308/655
                        HGVS:
                        NC_000002.11:g.160190209A>C, NC_000002.12:g.159333698A>C, NG_051314.1:g.383742T>G, NM_001289975.1:c.5689-1012T>G, NM_001329857.1:c.5740-1012T>G, NM_001329858.1:c.5722-1012T>G, NM_013450.3:c.5797-1012T>G, XM_005246488.1:c.5935-1012T>G, XM_005246488.2:c.5935-1012T>G, XM_005246489.1:c.5935-1012T>G, XM_005246489.4:c.5935-1012T>G, XM_005246490.1:c.5929-1012T>G, XM_005246491.1:c.5929-1012T>G, XM_005246492.1:c.5929-1012T>G, XM_005246492.4:c.5929-1012T>G, XM_005246493.1:c.5902-1012T>G, XM_005246494.1:c.5833-1012T>G, XM_005246495.1:c.5830-1012T>G, XM_005246496.1:c.5800-1012T>G, XM_005246497.1:c.5689-1012T>G, XM_005246498.1:c.5641-1012T>G, XM_005246499.1:c.5635-1012T>G, XM_005246500.1:c.5578-1012T>G, XM_005246501.1:c.5539-1012T>G, XM_005246502.1:c.5694-1012T>G, XM_005246503.1:c.3127-1012T>G, XM_006712461.3:c.5935-1012T>G, XM_011511038.2:c.5929-1012T>G, XM_011511039.1:c.5902-1012T>G, XM_011511042.1:c.5830-1012T>G, XM_011511043.1:c.5800-1012T>G, XM_011511044.1:c.5827-1012T>G, XM_011511045.1:c.5740-1012T>G, XM_011511047.1:c.5746-1012T>G, XM_011511048.2:c.5746-1012T>G, XM_011511050.1:c.5635-1012T>G, XM_011511051.1:c.5716-1012T>G, XM_011511052.1:c.5539-1012T>G, XM_011511053.2:c.5935-1012T>G, XM_011511054.2:c.5694-1012T>G, XM_011511056.1:c.3487-1012T>G, XM_017003918.1:c.5935-1012T>G, XM_017003919.1:c.5935-1012T>G, XM_017003920.1:c.5935-1012T>G, XM_017003921.1:c.5929-1012T>G, XM_017003922.1:c.5929-1012T>G, XM_017003923.1:c.5929-1012T>G, XM_017003924.1:c.5827-1012T>G, XM_017003925.1:c.5833-1012T>G, XM_017003926.1:c.5734-1012T>G, XM_017003927.1:c.5740-1012T>G, XM_017003928.1:c.5641-1012T>G, XM_017003929.1:c.5722-1012T>G, XM_017003930.1:c.5635-1012T>G, XM_017003931.1:c.5629-1012T>G, XM_017003932.1:c.5632-1012T>G, XM_017003933.1:c.5452-1012T>G, XM_017003934.1:c.5446-1012T>G, XM_017003935.1:c.5350-1012T>G, XM_017003936.1:c.5338-1012T>G, XM_017003937.1:c.3160-1012T>G, XR_001738732.1:n.5696-1012T>G, XR_001738733.1:n.5696-1012T>G
                        13.

                        rs4655058 [Homo sapiens]
                          TGACCTCCCGGGTTCAGGTGATCCT[C/T]CTGCTTCAGCCCCTCAAGTATCTGG
                          Chromosome:
                          1:22402068
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency
                          Global MAF:
                          T=0.2508/1256
                          HGVS:
                          NC_000001.10:g.22728561C>T, NC_000001.11:g.22402068C>T
                          14.

                          rs3193970 [Homo sapiens]
                            AATTTGAATGGAAGGGGGTAAAGGA[A/G]GTCATGAAGTTTTTTTGCATTTTTA
                            Chromosome:
                            10:95312251
                            Gene:
                            SORBS1 (GeneView)
                            Functional Consequence:
                            utr variant 3 prime
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.3474/1740
                            HGVS:
                            NC_000010.10:g.97072008T>C, NC_000010.11:g.95312251T>C, NG_034041.1:g.254170A>G, NM_001034954.1:c.*2808A>G, NM_001034955.1:c.*2808A>G, NM_001034956.1:c.*2808A>G, NM_001034957.1:c.*2808A>G, NM_001290294.1:c.*2808A>G, NM_001290295.1:c.*2808A>G, NM_001290296.1:c.*2808A>G, NM_001290297.1:c.*2808A>G, NM_001290298.1:c.*2808A>G, NM_006434.2:c.*2808A>G, NM_015385.3:c.*2808A>G, NM_024991.2:c.*2808A>G, XM_005269403.1:c.*2808A>G, XM_005269404.1:c.*2808A>G, XM_005269405.1:c.*2808A>G, XM_005269406.1:c.*2808A>G, XM_005269407.1:c.*2808A>G, XM_005269408.1:c.*2808A>G, XM_005269409.1:c.*2808A>G, XM_005269410.1:c.*2808A>G, XM_005269411.1:c.*2808A>G, XM_005269412.1:c.*2808A>G, XM_005269413.1:c.*2808A>G, XM_005269414.1:c.*2808A>G, XM_005269415.1:c.*2808A>G, XM_005269416.1:c.*2808A>G, XM_005269417.1:c.*2808A>G, XM_005269418.1:c.*2808A>G, XM_005269419.1:c.*2808A>G, XM_005269420.1:c.*2808A>G, XM_005269421.1:c.*2808A>G, XM_005269422.1:c.*2808A>G, XM_005269423.1:c.*2808A>G, XM_005269424.1:c.*2808A>G, XM_005269425.1:c.*2808A>G, XM_005269426.1:c.*2808A>G, XM_005269427.1:c.*2808A>G, XM_005269428.1:c.*2808A>G, XM_005269429.1:c.*2808A>G, XM_005269430.1:c.*2808A>G, XM_005269431.1:c.*2808A>G, XM_005269432.1:c.*2808A>G, XM_005269433.1:c.*2808A>G, XM_005269434.1:c.*2808A>G, XM_005269435.1:c.*2808A>G, XM_005269436.1:c.*2808A>G, XM_005269437.1:c.*2808A>G, XM_005269438.1:c.*2808A>G, XM_005269439.1:c.*2808A>G, XM_005269440.1:c.*2808A>G, XM_005269441.1:c.*2808A>G, XM_006717589.1:c.*2808A>G, XM_006717593.1:c.*2808A>G, XM_011539140.1:c.*2808A>G, XM_011539150.1:c.*2808A>G, XM_011539155.1:c.*2808A>G, XM_011539167.1:c.*2808A>G, XM_017015500.1:c.*2808A>G, XM_017015501.1:c.*2808A>G, XM_017015502.1:c.*2808A>G, XM_017015503.1:c.*2808A>G, XM_017015504.1:c.*2808A>G, XM_017015505.1:c.*2808A>G, XM_017015506.1:c.*2808A>G, XM_017015507.1:c.*2808A>G, XM_017015508.1:c.*2808A>G, XM_017015509.1:c.*2808A>G, XM_017015510.1:c.*2808A>G, XM_017015511.1:c.*2808A>G, XM_017015512.1:c.*2808A>G, XM_017015513.1:c.*2808A>G, XM_017015514.1:c.*2808A>G, XM_017015515.1:c.*2808A>G, XM_017015516.1:c.*2808A>G, XM_017015517.1:c.*2808A>G, XM_017015518.1:c.*2808A>G, XM_017015519.1:c.*2808A>G, XM_017015520.1:c.*2808A>G, XM_017015521.1:c.*2808A>G, XM_017015522.1:c.*2808A>G, XM_017015523.1:c.*2808A>G, XM_017015524.1:c.*2808A>G, XM_017015525.1:c.*2808A>G, XM_017015526.1:c.*2808A>G, XM_017015527.1:c.*2808A>G, XM_017015528.1:c.*2808A>G, XM_017015529.1:c.*2808A>G, XM_017015530.1:c.*2808A>G, XM_017015531.1:c.*2808A>G, XM_017015532.1:c.*2808A>G, XM_017015533.1:c.*2808A>G, XM_017015534.1:c.*2808A>G, XM_017015535.1:c.*2808A>G, XM_017015536.1:c.*2808A>G, XM_017015537.1:c.*2808A>G, XM_017015538.1:c.*2808A>G, XM_017015539.1:c.*2808A>G, XM_017015540.1:c.*2808A>G
                            15.

                            rs2650907 [Homo sapiens]
                              TCACATAAAGTAGTGGTTCAAAGAG[C/G]CACTTACTTGTGCCCTGACTCATGA
                              Chromosome:
                              16:77359310
                              Gene:
                              ADAMTS18 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              C=0.4625/2316
                              HGVS:
                              NC_000016.10:g.77359310G>C, NC_000016.9:g.77393207G>C, NG_031879.2:g.80805C>G, NM_001326358.1:c.806+8C>G, NM_199355.3:c.1322+8C>G, XM_011522923.1:c.806+8C>G, XM_011522924.1:c.806+8C>G, XM_017022988.1:c.86+8C>G, XM_017022989.1:c.86+8C>G
                              16.

                              rs2178490 [Homo sapiens]
                                ATAATTGTACAATTCCATTCCAGCA[C/T]GAGGAAACCAGGCCATTTTGGTGAT
                                Chromosome:
                                5:30839224
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.4020/2013
                                HGVS:
                                NC_000005.10:g.30839224A>G, NC_000005.9:g.30839331A>G
                                17.

                                rs174230 [Homo sapiens]
                                  GTGGCCAAACTTCTGTAGCCTGAAA[A/G]CCTCTCTGGTCTGCGAACTTCTCCG
                                  Chromosome:
                                  2:159318799
                                  Gene:
                                  BAZ2B (GeneView)
                                  Functional Consequence:
                                  downstream variant 500B,intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.1560/781
                                  HGVS:
                                  NC_000002.11:g.160175310T>C, NC_000002.12:g.159318799T>C, NG_051314.1:g.398641A>G, NM_001289975.1:c.*1466A>G, NM_001329857.1:c.*1466A>G, NM_001329858.1:c.*1466A>G, NM_013450.3:c.*1466A>G, XM_005246488.1:c.*1466A>G, XM_005246488.2:c.6636+1475A>G, XM_005246489.1:c.*1466A>G, XM_005246489.4:c.6636+1475A>G, XM_005246490.1:c.*1466A>G, XM_005246491.1:c.*1466A>G, XM_005246492.1:c.*1466A>G, XM_005246492.4:c.6630+1475A>G, XM_005246493.1:c.*1466A>G, XM_005246494.1:c.*1466A>G, XM_005246495.1:c.*1466A>G, XM_005246496.1:c.*1466A>G, XM_005246497.1:c.*1466A>G, XM_005246498.1:c.*1466A>G, XM_005246499.1:c.*1466A>G, XM_005246500.1:c.*1466A>G, XM_005246501.1:c.*1466A>G, XM_005246503.1:c.*1466A>G, XM_006712461.3:c.6636+1475A>G, XM_011511038.2:c.6630+1475A>G, XM_011511039.1:c.6603+1475A>G, XM_011511042.1:c.6531+1475A>G, XM_011511043.1:c.6501+1475A>G, XM_011511044.1:c.*1466A>G, XM_011511045.1:c.6441+1475A>G, XM_011511047.1:c.6447+1475A>G, XM_011511048.2:c.6447+1475A>G, XM_011511050.1:c.6336+1475A>G, XM_011511051.1:c.*1466A>G, XM_011511052.1:c.6240+1475A>G, XM_011511056.1:c.4188+1475A>G, XM_017003918.1:c.6636+1475A>G, XM_017003919.1:c.6636+1475A>G, XM_017003920.1:c.6636+1475A>G, XM_017003921.1:c.6630+1475A>G, XM_017003922.1:c.6630+1475A>G, XM_017003923.1:c.*1466A>G, XM_017003924.1:c.6528+1475A>G, XM_017003925.1:c.6534+1475A>G, XM_017003926.1:c.6435+1475A>G, XM_017003927.1:c.*1466A>G, XM_017003928.1:c.6342+1475A>G, XM_017003929.1:c.*1466A>G, XM_017003930.1:c.6336+1475A>G, XM_017003931.1:c.6330+1475A>G, XM_017003932.1:c.*1466A>G, XM_017003933.1:c.6153+1475A>G, XM_017003934.1:c.6147+1475A>G, XM_017003935.1:c.6051+1475A>G, XM_017003936.1:c.*1466A>G, XM_017003937.1:c.3861+1475A>G, XR_001738732.1:n.7872A>G, XR_001738733.1:n.6397+1475A>G

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center