Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 26

2.

rs12447304 [Homo sapiens]
    AGCCACTACTAGGTGCCAAGCACTT[C/G]CTAGGTCCTGGGGATACAGTGGAGA
    Chromosome:
    16:23670950
    Gene:
    DCTN5 (GeneView)
    Functional Consequence:
    nc transcript variant,utr variant 3 prime
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0286/143
    HGVS:
    NC_000016.10:g.23670950C>G, NC_000016.9:g.23682271C>G, NM_001199743.1:c.*3926C>G, NM_032486.3:c.*3806C>G, NR_037573.1:n.4633C>G, XR_001752006.1:n.2663C>G, XR_001752007.1:n.2693C>G
    3.

    rs12405120 [Homo sapiens]
      AGTTGAATTAGATTCTGCACTTTGA[C/T]GGAAGGAGTTAGAAAAATTTGGGGA
      Chromosome:
      1:84090840
      Gene:
      PRKACB (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.2917/1461
      HGVS:
      NC_000001.10:g.84556523T>C, NC_000001.11:g.84090840T>C, NG_029728.1:g.17779T>C, NM_002731.3:c.46+12469T>C, NM_207578.2:c.46+12469T>C, XM_017001713.1:c.46+12469T>C
      4.

      5.

      rs12031680 [Homo sapiens]
        cctttttacctttctatcaaaagca[A/C]ctctctatatttttaacctttttac
        Chromosome:
        1:84069614
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4860/2434
        HGVS:
        NC_000001.10:g.84535297C>A, NC_000001.11:g.84069614C>A
        6.

        rs10094059 [Homo sapiens]
          GAGGAAACTCTTCTTTGAATTCAAA[C/G]AGAAGGGTCCAAGCCACCTTTTCTG
          Chromosome:
          8:127449362
          Gene:
          CASC8 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2847/1426
          HGVS:
          NC_000008.10:g.128461607C>G, NC_000008.11:g.127449362C>G, NR_024393.1:n.1042-5642G>C, NR_117100.1:n.1042-28399G>C
          8.

          rs7929469 [Homo sapiens]
            gggagtgggggaagggtctgtcaag[A/G]ctgtacaattcaagactgtatttcc
            Chromosome:
            11:9563712
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.2185/1094
            HGVS:
            NC_000011.10:g.9563712G>A, NC_000011.9:g.9585259G>A
            9.
            10.

            rs5745720 [Homo sapiens]
              ACCAAATAGAGGCAAAATCACAAAA[C/T]CTAATATGCCAATTATGGAGCCCTC
              Chromosome:
              7:81717609
              Gene:
              HGF (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1258/630
              HGVS:
              NC_000007.13:g.81346925G>A, NC_000007.14:g.81717609G>A, NG_016274.2:g.57528C>T, NM_000601.5:c.1272-244C>T, NM_001010932.2:c.1257-244C>T, XM_006715956.2:c.1272-244C>T, XM_011516115.2:c.1257-244C>T
              11.

              rs5745709 [Homo sapiens]
                TCATAGAGAAGGTAGCACCCACTCA[A/G]CCCTAGCAATAGTGCTAGTGTTTAC
                Chromosome:
                7:81720096
                Gene:
                HGF (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.1148/575
                HGVS:
                NC_000007.13:g.81349412T>C, NC_000007.14:g.81720096T>C, NG_016274.2:g.55041A>G, NM_000601.5:c.1271+649A>G, NM_001010932.2:c.1256+649A>G, XM_006715956.2:c.1271+649A>G, XM_011516115.2:c.1256+649A>G
                12.

                rs5745687 [Homo sapiens]
                  CACTGATGTTCCTTTGGAAACAACT[A/G]AATGCATCCAAGGTCAAGGAGAAGG
                  Chromosome:
                  7:81729735
                  Gene:
                  HGF (GeneView)
                  Functional Consequence:
                  missense
                  Clinical significance:
                  Likely benign
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.0198/99
                  HGVS:
                  NC_000007.13:g.81359051C>T, NC_000007.14:g.81729735C>T, NG_016274.2:g.45402G>A, NM_000601.5:c.910G>A, NM_001010932.2:c.895G>A, NP_000592.3:p.Glu304Lys, NP_001010932.1:p.Glu299Lys, XM_006715956.2:c.910G>A, XM_011516115.2:c.895G>A, XP_006716019.1:p.Glu304Lys, XP_011514417.1:p.Glu299Lys
                  13.

                  rs3807446 [Homo sapiens]
                    AGAGTTATAGCTCAGTAAACCCACG[C/T]TGCATCTGCCTTCACTCACAAAAGT
                    Chromosome:
                    7:148770355
                    Gene:
                    CUL1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.0551/276
                    HGVS:
                    NC_000007.13:g.148467447T>C, NC_000007.14:g.148770355T>C, NM_003592.2:c.1083+2606T>C, XM_005250060.1:c.1083+2606T>C, XM_005250060.4:c.1083+2606T>C, XM_005250061.1:c.1083+2606T>C, XM_011516629.2:c.1083+2606T>C, XM_011516630.2:c.1083+2606T>C, XM_011516631.2:c.1083+2606T>C, XM_011516632.2:c.1083+2606T>C, XM_017012723.1:c.120+2606T>C
                    14.

                    rs2887069 [Homo sapiens]
                      AGTGAATAAACATAAGAAAAATCCA[A/G]CTTCAAACTTGGTGATTTTGTTTGC
                      Chromosome:
                      7:81725750
                      Gene:
                      HGF (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.1649/826
                      HGVS:
                      NC_000007.13:g.81355066G>A, NC_000007.14:g.81725750G>A, NG_016274.2:g.49387C>T, NM_000601.5:c.1168+140C>T, NM_001010932.2:c.1153+140C>T, XM_006715956.2:c.1168+140C>T, XM_011516115.2:c.1153+140C>T
                      16.

                      rs2227562 [Homo sapiens]
                        GCTGGCCATAGCACAAGAGAAGTGC[A/G]GCCTCTGGTTGAGTCTTCCCTGAGG
                        Chromosome:
                        10:73913203
                        Gene:
                        C10orf55 (GeneView) PLAU (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        A=0.1671/837
                        HGVS:
                        NC_000010.10:g.75672961G>A, NC_000010.11:g.73913203G>A, NG_011904.1:g.7100G>A, NM_001001791.2:c.-73-128C>T, NM_001145031.1:c.318-87G>A, NM_001145031.2:c.318-87G>A, NM_001319191.1:c.111-87G>A, NM_002658.3:c.369-87G>A, NM_002658.4:c.369-87G>A, XM_005269901.1:c.111-87G>A, XM_011539866.2:c.369-87G>A
                        17.

                        rs2214825 [Homo sapiens]
                          GAGATTTACCTCGGCAGTACCATAG[C/T]GTGGATAATATTCAGTTAGGTTTGT
                          Chromosome:
                          7:81742303
                          Gene:
                          HGF (GeneView)
                          Functional Consequence:
                          downstream variant 500B,intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          T=0.1480/741
                          HGVS:
                          NC_000007.13:g.81371619T>C, NC_000007.14:g.81742303T>C, NG_016274.2:g.32834A>G, NM_000601.5:c.865+1050A>G, NM_001010931.2:c.*639A>G, NM_001010932.2:c.850+1050A>G, NM_001010933.2:c.*639A>G, XM_006715956.2:c.865+1050A>G, XM_011516115.2:c.850+1050A>G, XM_017012097.1:c.*639A>G, XM_017012098.1:c.*639A>G
                          18.

                          rs2074725 [Homo sapiens]
                            GCACAAATTATAGTCCAGAGCTTAC[A/C]GTCTGGCAAGCAGATGTGATCAGCT
                            Chromosome:
                            7:81709988
                            Gene:
                            HGF (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.2236/1120
                            HGVS:
                            NC_000007.13:g.81339304A>C, NC_000007.14:g.81709988A>C, NG_016274.2:g.65149T>G, NM_000601.5:c.1541+159T>G, NM_001010932.2:c.1526+159T>G, XM_006715956.2:c.1541+159T>G, XM_011516115.2:c.1526+159T>G
                            19.

                            rs1810132 [Homo sapiens]
                              CTGCTGTTTGTGCCTCTCTCTGTTA[C/T]TAACCCGTCCTCTCGCTGTTAGACA
                              Chromosome:
                              17:39709752
                              Gene:
                              ERBB2 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              C=0.4163/2085
                              HGVS:
                              NC_000017.10:g.37866005C>T, NC_000017.11:g.39709752C>T, NG_007503.1:g.26613C>T, NM_001005862.2:c.485-61C>T, NM_001289936.1:c.530-61C>T, NM_001289937.1:c.575-61C>T, NM_001289938.1:c.485-61C>T, NM_004448.3:c.575-61C>T, NR_110535.1:n.899-61C>T, XM_005257139.1:c.530-61C>T, XM_005257140.1:c.485-61C>T
                              20.

                              rs1800793 [Homo sapiens]
                                GTGATGTGCAAGGCCTGTTGTTTCC[A/G/T]CAGTCATATCTTCTGGGAACCAGAT
                                Chromosome:
                                7:81717369
                                Gene:
                                HGF (GeneView)
                                Functional Consequence:
                                intron variant
                                Clinical significance:
                                Likely benign
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                T=0.2017/1010
                                HGVS:
                                NC_000007.13:g.81346685T>C, NC_000007.14:g.81717369T>C, NG_016274.2:g.57768A>G, NM_000601.5:c.1272-4A>G, NM_001010932.2:c.1257-4A>G, XM_006715956.2:c.1272-4A>G, XM_011516115.2:c.1257-4A>G

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center