Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 24

1.

rs17412370 [Homo sapiens]
    GCTCCAGAGCATCAAATAATCTGAT[G/T]AACCATGAACCACATCTGGTTAGGT
    Chromosome:
    11:81015321
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0929/465
    HGVS:
    NC_000011.10:g.81015321T>G, NC_000011.9:g.80726364T>G
    2.

    rs16893526 [Homo sapiens]
      TGTTCCACCATCAACACTGAATATC[A/G]CTTTTGTATGTAAGCTCATGTCATC
      Chromosome:
      6:81805598
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0974/488
      HGVS:
      NC_000006.11:g.82515315G>A, NC_000006.12:g.81805598G>A
      3.

      rs16893523 [Homo sapiens]
        ATTGTTCTCATGAATAATGTAAATC[A/G]CTAAATCATAAGTAGTGCTTTGTGC
        Chromosome:
        6:81794462
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.1334/668
        HGVS:
        NC_000006.11:g.82504179G>A, NC_000006.12:g.81794462G>A
        4.

        rs13197670 [Homo sapiens]
          TGTGATCTTCATGTTCTGCTTTCTT[C/G]TGCAAAGGCATTCATCTTTTACGTA
          Chromosome:
          6:81860167
          Gene:
          LOC102724168 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.0988/495
          HGVS:
          NC_000006.11:g.82569884G>C, NC_000006.12:g.81860167G>C, XR_001744229.1:n.400-14258C>G, XR_001744230.1:n.656-14258C>G, XR_427990.3:n.147-14258C>G, XR_942733.2:n.237-14258C>G, XR_942734.2:n.1274-14258C>G, XR_942735.2:n.320-14258C>G
          5.

          rs11143677 [Homo sapiens]
            CAATGAATTGAGGATTAGAGCAAAT[A/G]AGTGAATATACTGATGTTTTTGGGA
            Chromosome:
            9:73720400
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.3972/1989
            HGVS:
            NC_000009.11:g.76335316G>A, NC_000009.12:g.73720400G>A
            7.

            rs7848524 [Homo sapiens]
              atgtatgaaagatccagttgctcca[C/G/T]gttgttttgttcactgtcatggtgg
              Chromosome:
              9:21701433
              Gene:
              LOC107987026 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3996/2001
              HGVS:
              NC_000009.11:g.21701432T>C, NC_000009.12:g.21701433T>C, NC_000009.12:g.21701433T>G, XR_001746563.1:n.384+1484A>C, XR_001746563.1:n.384+1484A>G
              9.

              rs6725887 [Homo sapiens]
                CTATCATTTAAATTTGGTTGAGACA[C/T]AATATGCTGTTGCACTTTCTATAAA
                Chromosome:
                2:202881162
                Gene:
                WDR12 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.0469/235
                HGVS:
                NC_000002.11:g.203745885T>C, NC_000002.12:g.202881162T>C, NM_018256.3:c.1195-225A>G, XM_011511469.2:c.781-225A>G
                10.

                rs6682490 [Homo sapiens]
                  TCTGCTCTCAATTCTCTTTCTGCTT[A/T]GACTCAGCGTCACTTCTAACTGGGA
                  Chromosome:
                  1:88359607
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.1763/883
                  HGVS:
                  NC_000001.10:g.88825290T>A, NC_000001.11:g.88359607T>A
                  11.

                  rs4849561 [Homo sapiens]
                    ACACCTTTGGACCTAGAGTCAGTGC[C/T]CTAAACCACTTGGCTGCTACACAAA
                    Chromosome:
                    2:117516426
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.1044/523
                    HGVS:
                    NC_000002.11:g.118274002T>C, NC_000002.12:g.117516426T>C
                    12.

                    rs4692845 [Homo sapiens]
                      ATAGTTAATTATTTCATAGTTCATT[A/G]CATCTAGAACCAGGTGGTACAAAAG
                      Chromosome:
                      4:170614130
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.4794/2401
                      HGVS:
                      NC_000004.11:g.171535281G>A, NC_000004.12:g.170614130G>A, NG_025183.1:g.97C>T
                      13.

                      rs2782552 [Homo sapiens]
                        TCTCTGTAAGAAATTGGCAAACTGA[A/C]TTCTAGTTCATATCTGAACATGTTT
                        Chromosome:
                        6:159222664
                        Gene:
                        FNDC1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.4912/2460
                        HGVS:
                        NC_000006.11:g.159643696C>A, NC_000006.12:g.159222664C>A, NM_032532.2:c.767-864C>A, XM_005267165.1:c.542-864C>A, XM_011536190.2:c.698-864C>A, XM_011536191.2:c.416-864C>A
                        14.

                        rs2246833 [Homo sapiens]
                          GCCTCTTTGTTTCCATCCTGCCTAC[C/T]GGGCACAAATAAATGCTCATTTCTT
                          Chromosome:
                          10:89246097
                          Gene:
                          LIPA (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.4249/2128
                          HGVS:
                          NC_000010.10:g.91005854C>T, NC_000010.11:g.89246097C>T, NG_008194.1:g.10807G>A, NM_000235.3:c.112-304G>A, NM_001127605.2:c.112-304G>A, NM_001288979.1:c.-120+5640G>A
                          15.

                          rs1421521 [Homo sapiens]
                            CAACCATGGAGTCCCACACTCTTTA[A/G]GAAGATGATCTTGGAAAAGGAAAGG
                            Chromosome:
                            18:64418271
                            Gene:
                            LINC01924 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.2841/1423
                            HGVS:
                            NC_000018.10:g.64418271G>A, NC_000018.9:g.62085506G>A, NR_033881.1:n.977+2160G>A
                            16.

                            rs1412444 [Homo sapiens]
                              GGTTGTTGCCACTGGTGTTATTTCC[A/G]GTGTTTAAAGGCAAATAGATAAAAA
                              Chromosome:
                              10:89243170
                              Gene:
                              LIPA (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              T=0.4181/2094
                              HGVS:
                              NC_000010.10:g.91002927C>T, NC_000010.11:g.89243170C>T, NG_008194.1:g.13734G>A, NM_000235.3:c.229+2506G>A, NM_001127605.2:c.229+2506G>A, NM_001288979.1:c.-120+8567G>A
                              17.

                              rs1348330 [Homo sapiens]
                                CTACACTGGGCTCACTCATGTTGCA[A/G]ACACCAAAGCCAACACCATAGTAAG
                                Chromosome:
                                4:170631706
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                C=0.4752/2380
                                HGVS:
                                NC_000004.11:g.171552857T>C, NC_000004.12:g.170631706T>C
                                18.

                                rs1333049 [Homo sapiens]
                                  CATACTAACCATATGATCAACAGTT[C/G]AAAAGCAGCCACTCGCAGAGGTAAG
                                  Chromosome:
                                  9:22125504
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  C=0.4181/2094
                                  HGVS:
                                  NC_000009.11:g.22125503G>C, NC_000009.12:g.22125504G>C
                                  19.

                                  rs646776 [Homo sapiens]
                                    TATTTGGGAGCAGTGTCATGGACAT[A/G]GGCAGAGGGACAGGCTTATCAGCCA
                                    Chromosome:
                                    1:109275908
                                    Gene:
                                    CELSR2 (GeneView)
                                    Functional Consequence:
                                    downstream variant 500B
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                    Global MAF:
                                    C=0.2384/1194
                                    HGVS:
                                    NC_000001.10:g.109818530C>T, NC_000001.11:g.109275908C>T, NM_001408.2:c.*1859C>T, XM_005270580.1:c.*1726C>T, XM_005270580.4:c.*1726C>T
                                    20.

                                    rs629301 [Homo sapiens]
                                      AAAACAACAACAACAAAACGCTACC[A/C]TATTTACAGCAACAACCAAACTGTA
                                      Chromosome:
                                      1:109275684
                                      Gene:
                                      CELSR2 (GeneView)
                                      Functional Consequence:
                                      utr variant 3 prime
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                      Global MAF:
                                      G=0.2390/1197
                                      HGVS:
                                      NC_000001.10:g.109818306G>T, NC_000001.11:g.109275684G>T, NM_001408.2:c.*1635G>T, XM_005270580.1:c.*1502G>T, XM_005270580.4:c.*1502G>T

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center