Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 24

1.

rs17281995 [Homo sapiens]
    CCCAGCATAGGGCTAGCAAATTTGA[C/G]TTGGATGATTGTTTTTGCTCAAGGC
    Chromosome:
    3:122120794
    Gene:
    CD86 (GeneView)
    Functional Consequence:
    utr variant 3 prime
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1058/530
    HGVS:
    NC_000003.11:g.121839641G>C, NC_000003.12:g.122120794G>C, NG_029928.1:g.70431G>C, NM_001206924.1:c.*1258G>C, NM_001206925.1:c.*1258G>C, NM_006889.4:c.*1258G>C, NM_175862.4:c.*1258G>C, NM_176892.1:c.*1258G>C, XM_005247905.1:c.*1260G>C, XM_005247906.1:c.*1260G>C
    2.
    3.

    rs12779790 [Homo sapiens]
      cccggACAatgttgggaattttttc[A/G]tatttcttggccatttatatatctt
      Chromosome:
      10:12286011
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1579/791
      HGVS:
      NC_000010.10:g.12328010A>G, NC_000010.11:g.12286011A>G
      4.

      rs10923931 [Homo sapiens]
        CTTGTTGCTCCATCCTCTGGCTTCA[G/T]GCTGAACAAGTAAGATTATGGGCAC
        Chromosome:
        1:119975336
        Gene:
        NOTCH2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1921/962
        HGVS:
        NC_000001.10:g.120517959G>T, NC_000001.11:g.119975336G>T, NG_008163.1:g.99318C>A, NM_001200001.1:c.875-5592C>A, NM_024408.3:c.875-5592C>A, NW_003871056.3:g.46910G>T, XM_005270901.1:c.758-5592C>A, XM_005270901.3:c.758-5592C>A, XM_005270902.1:c.758-5592C>A, XM_011541519.2:c.863-5592C>A, XM_011541520.2:c.758-5592C>A, XM_017001372.1:c.827-5592C>A, XM_017001373.1:c.758-5592C>A
        5.

        rs10426094 [Homo sapiens]
          CTAATGGTTAGAACAGACCTTTCCA[C/T]AGCCTAGAGGGTAGACAGAGAGAAA
          Chromosome:
          19:7205229
          Gene:
          INSR (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.1536/769
          HGVS:
          NC_000019.10:g.7205229C>T, NC_000019.9:g.7205240C>T, NG_008852.2:g.93772G>A, NM_000208.3:c.653-20592G>A, NM_001079817.2:c.653-20592G>A, XM_005259552.1:c.671-20592G>A, XM_005259553.1:c.671-20592G>A, XM_005259554.1:c.542-20592G>A, XM_011527988.2:c.653-20592G>A, XM_011527989.2:c.653-20592G>A
          6.

          rs10010131 [Homo sapiens]
            CACACAAGGCCTTTGACCACATCCT[A/G]TCCCTCAGGCATCACGTCCGAGAAC
            Chromosome:
            4:6291188
            Gene:
            WFS1 (GeneView)
            Functional Consequence:
            intron variant
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            other
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2712/1358
            HGVS:
            NC_000004.11:g.6292915A>G, NC_000004.12:g.6291188A>G, NG_011700.1:g.26339A>G, NM_001145853.1:c.461-9A>G, NM_006005.2:c.461-9A>G, NM_006005.3:c.461-9A>G, XM_017008586.1:c.470-9A>G
            7.

            rs7961581 [Homo sapiens]
              CTGGATGCCAAAGCTCAGGAGTAAA[C/T]GAGGATGAAAAGTAGTTATCAACTC
              Chromosome:
              12:71269322
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.2384/1194
              HGVS:
              NC_000012.11:g.71663102C>T, NC_000012.12:g.71269322C>T
              8.

              rs7903146 [Homo sapiens]
                TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG
                Chromosome:
                10:112998590
                Gene:
                TCF7L2 (GeneView)
                Functional Consequence:
                intron variant
                Allele Origin:
                T(germline)/C(germline)
                Clinical significance:
                drug-response
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.2278/1141
                HGVS:
                NC_000010.10:g.114758349C>T, NC_000010.11:g.112998590C>T, NG_012631.1:g.53341C>T, NM_001146274.1:c.450+33966C>T, NM_001146283.1:c.382-41435C>T, NM_001146284.1:c.382-41435C>T, NM_001146285.1:c.382-41435C>T, NM_001146286.1:c.382-41435C>T, NM_001198525.1:c.382-41435C>T, NM_001198526.1:c.382-41435C>T, NM_001198527.1:c.382-41435C>T, NM_001198528.1:c.382-41435C>T, NM_001198529.1:c.382-41435C>T, NM_001198530.1:c.381+46983C>T, NM_001198531.1:c.450+33966C>T, NM_030756.4:c.382-41435C>T, XM_005270071.1:c.450+33966C>T, XM_005270072.1:c.450+33966C>T, XM_005270073.1:c.450+33966C>T, XM_005270074.1:c.450+33966C>T, XM_005270075.1:c.450+33966C>T, XM_005270076.1:c.450+33966C>T, XM_005270077.1:c.450+33966C>T, XM_005270078.1:c.450+33966C>T, XM_005270079.1:c.450+33966C>T, XM_005270080.1:c.382-41435C>T, XM_005270081.1:c.382-41435C>T, XM_005270082.1:c.450+33966C>T, XM_005270083.1:c.450+33966C>T, XM_005270084.1:c.450+33966C>T, XM_005270085.1:c.450+33966C>T, XM_005270086.1:c.382-41435C>T, XM_005270087.1:c.382-41435C>T, XM_005270088.1:c.382-41435C>T, XM_005270089.1:c.382-41435C>T, XM_005270090.1:c.381+46983C>T, XM_005270091.1:c.450+33966C>T, XM_005270091.2:c.450+33966C>T, XM_005270092.1:c.450+33966C>T, XM_005270093.1:c.450+33966C>T, XM_005270093.2:c.450+33966C>T, XM_005270094.1:c.450+33966C>T, XM_005270094.2:c.450+33966C>T, XM_005270095.1:c.450+33966C>T, XM_005270096.1:c.450+33966C>T, XM_005270096.2:c.450+33966C>T, XM_005270100.1:c.450+33966C>T, XM_005270101.1:c.382-41435C>T, XM_005270101.2:c.382-41435C>T, XM_005270102.1:c.450+33966C>T, XM_005270103.1:c.382-41435C>T, XM_005270104.1:c.382-41435C>T, XM_011540109.1:c.450+33966C>T, XM_011540110.1:c.382-41435C>T, XM_011540111.1:c.382-41435C>T, XM_011540113.2:c.450+33966C>T, XM_011540116.1:c.450+33966C>T, XM_017016584.1:c.450+33966C>T, XM_017016585.1:c.450+33966C>T, XM_017016586.1:c.450+33966C>T, XM_017016587.1:c.450+33966C>T, XM_017016588.1:c.382-41435C>T, XM_017016589.1:c.450+33966C>T, XM_017016590.1:c.450+33966C>T, XM_017016591.1:c.450+33966C>T, XM_017016592.1:c.450+33966C>T, XM_017016593.1:c.450+33966C>T, XM_017016594.1:c.382-41435C>T, XM_017016595.1:c.450+33966C>T, XM_017016596.1:c.450+33966C>T
                11.

                rs4607103 [Homo sapiens]
                  ATAATTCCTCAGGCCCAGCAGGTTT[C/T]TCAACTTGACTTTTCTTAGGTTATT
                  Chromosome:
                  3:64726228
                  Gene:
                  ADAMTS9-AS2 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency
                  Global MAF:
                  T=0.3540/1773
                  HGVS:
                  NC_000003.11:g.64711904C>T, NC_000003.12:g.64726228C>T, NR_038264.1:n.469+40890C>T
                  13.

                  rs2383208 [Homo sapiens]
                    TAAAACTGTGACAGGAAGGAAGTCC[A/G]CATGAATTGAGCATCTACTAGTTTC
                    Chromosome:
                    9:22132077
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    G=0.2101/1052
                    HGVS:
                    NC_000009.11:g.22132076A>G, NC_000009.12:g.22132077A>G
                    14.

                    rs2237897 [Homo sapiens]
                      TCAGTGGTGCCCAGGGAGCTGGGGA[C/T]GAGGGGCCTCATCCTTCCCCTGAGC
                      Chromosome:
                      11:2837316
                      Gene:
                      KCNQ1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.1422/712
                      HGVS:
                      NC_000011.10:g.2837316C>T, NC_000011.9:g.2858546C>T, NG_008935.1:g.397326C>T, NM_000218.2:c.1795-10451C>T, NM_181798.1:c.1414-10451C>T, NR_040711.2:n.1688-10451C>T, NT_187585.1:g.69495C>T
                      15.

                      rs2237895 [Homo sapiens]
                        GTGATCGGGCCCGGTCAGTGGTCCC[A/C]GGGGTCGGGGACAGGTGGGAATCGA
                        Chromosome:
                        11:2835964
                        Gene:
                        KCNQ1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        C=0.3229/1617
                        HGVS:
                        NC_000011.10:g.2835964A>C, NC_000011.9:g.2857194A>C, NG_008935.1:g.395974A>C, NM_000218.2:c.1795-11803A>C, NM_181798.1:c.1414-11803A>C, NR_040711.2:n.1688-11803A>C, NT_187585.1:g.68142A>C
                        16.

                        rs2237892 [Homo sapiens]
                          GGAGCTGTCACAGGACTTTGCCACC[C/T]GGGGTGAGGGGCCTAGAAACCCCTC
                          Chromosome:
                          11:2818521
                          Gene:
                          KCNQ1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.1490/746
                          HGVS:
                          NC_000011.10:g.2818521C>T, NC_000011.9:g.2839751C>T, NG_008935.1:g.378531C>T, NM_000218.2:c.1795-29246C>T, NM_181798.1:c.1414-29246C>T, NR_040711.2:n.1688-29246C>T, NT_187585.1:g.50708C>T
                          17.

                          rs2074196 [Homo sapiens]
                            CAGAGCTGGGGGTGATGGGGCTTCA[G/T]TGGAGCCCGCCAGGACTGGGGACAC
                            Chromosome:
                            11:2803570
                            Gene:
                            KCNQ1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.1609/806
                            HGVS:
                            NC_000011.10:g.2803570G>T, NC_000011.9:g.2824800G>T, NG_008935.1:g.363580G>T, NM_000218.2:c.1794+25533G>T, NM_181798.1:c.1413+25533G>T, NR_040711.2:n.1687+25533G>T, NT_187585.1:g.35757G>T
                            18.

                            rs1801282 [Homo sapiens]
                              AACTCTGGGAGATTCTCCTATTGAC[C/G]CAGAAAGCGATTCCTTCACTGATAC
                              Chromosome:
                              3:12351626
                              Gene:
                              PPARG (GeneView)
                              Functional Consequence:
                              intron variant,missense
                              Allele Origin:
                              G(germline)/C(germline)
                              Clinical significance:
                              Likely benign
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.0703/352
                              HGVS:
                              NC_000003.11:g.12393125C>G, NC_000003.12:g.12351626C>G, NG_011749.1:g.68777C>G, NM_001330615.1:c.-2-28078C>G, NM_005037.5:c.-2-28078C>G, NM_015869.4:c.34C>G, NM_138711.3:c.-2-28078C>G, NM_138712.3:c.-2-28078C>G, NP_056953.2:p.Pro12Ala, XM_011533841.2:c.-2-28078C>G, XM_011533842.2:c.34C>G, XM_011533843.2:c.34C>G, XM_011533844.1:c.-2-28078C>G, XP_011532144.1:p.Pro12Ala, XP_011532145.1:p.Pro12Ala
                              20.

                              rs1255372 [Homo sapiens]
                                ttaaagcttgggaaaaaaatcacta[C/T]aggtgtagaacaatacccttccttt
                                Chromosome:
                                10:42496332
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.2865/1435
                                HGVS:
                                NC_000010.10:g.42991780T>C, NC_000010.11:g.42496332T>C

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center