Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs3732378 [Homo sapiens]
    CAGGCAACAATGGCTAAATGCAACC[A/G]TCTCAGTCACACTGAGGGCCAGCCT
    Chromosome:
    3:39265671
    Gene:
    CX3CR1 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0855/428
    HGVS:
    NC_000003.11:g.39307162G>A, NC_000003.12:g.39265671G>A, NG_016362.1:g.21065C>T, NM_001171171.1:c.839C>T, NM_001171172.1:c.839C>T, NM_001171174.1:c.935C>T, NM_001337.3:c.839C>T, NP_001164642.1:p.Thr280Met, NP_001164643.1:p.Thr280Met, NP_001164645.1:p.Thr312Met, NP_001328.1:p.Thr280Met

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center