Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 30

1.

rs17161983 [Homo sapiens]
    TAGAGTATTACACGTTGCATACTAC[A/G]AAGCAGGTGACAAATCAATGCCAAA
    Chromosome:
    7:99866195
    Gene:
    CYP3A43 (GeneView)
    Functional Consequence:
    downstream variant 500B,utr variant 3 prime
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0751/376
    HGVS:
    NC_000007.13:g.99463818A>G, NC_000007.14:g.99866195A>G, NG_007935.1:g.43183A>G, NM_001278921.1:c.*194A>G, NM_022820.4:c.*194A>G, NM_057095.2:c.*194A>G, NM_057096.3:c.*280A>G, NR_103868.1:n.1503A>G, NR_103869.1:n.1930A>G, XM_017012542.1:c.*194A>G, XM_017012543.1:c.*194A>G, XM_017012544.1:c.*194A>G, XM_017012545.1:c.*194A>G
    2.
    3.

    rs12535293 [Homo sapiens]
      tggtcgcaaaataatgaCCATGATC[A/G]ATTTCAAGCCATCAAAGTTTGACAA
      Chromosome:
      7:99857481
      Gene:
      CYP3A43 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0781/391
      HGVS:
      NC_000007.13:g.99455104G>A, NC_000007.14:g.99857481G>A, NG_007935.1:g.34469G>A, NM_001278921.1:c.535+582G>A, NM_022820.4:c.865+582G>A, NM_057095.2:c.865+582G>A, NM_057096.3:c.865+582G>A, NR_103868.1:n.825+582G>A, NR_103869.1:n.1089+582G>A, XM_017012542.1:c.535+582G>A, XM_017012543.1:c.535+582G>A, XM_017012544.1:c.433+582G>A, XM_017012545.1:c.433+582G>A
      4.

      rs11631682 [Homo sapiens]
        AAAACAAGTAGCTGAGCACAGTTGG[A/G]CAAATTTCAGCAACCATCGCACACC
        Chromosome:
        15:74764017
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0667/334
        HGVS:
        NC_000015.10:g.74764017G>A, NC_000015.9:g.75056358G>A
        5.

        rs10458360 [Homo sapiens]
          GAGACTCAATCCTGGCACTTGTAGA[C/G]TTTCAATATGTGCCTGTAAAGTGGA
          Chromosome:
          1:172664835
          Gene:
          FASLG (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.3942/1974
          HGVS:
          NC_000001.10:g.172633975G>C, NC_000001.11:g.172664835G>C, NG_007269.1:g.10791G>C, NM_000639.1:c.451+445G>C, NM_000639.2:c.451+445G>C, NM_001302746.1:c.*21+445G>C
          7.

          rs6960542 [Homo sapiens]
            TGGCCCGAAATGCCAATCCATATAG[C/T]CTTTGCCACTCTGTGTCAACTGTAC
            Chromosome:
            7:99985596
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.0489/245
            HGVS:
            NC_000007.13:g.99583219C>T, NC_000007.14:g.99985596C>T
            8.

            rs6002616 [Homo sapiens]
              TGTGAGCTCCTTTCACAAGGCCAGC[A/G]ATATCCACTACATTTAGAAAGGCAG
              Chromosome:
              22:42108675
              Gene:
              NDUFA6-AS1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.3265/1635
              HGVS:
              NC_000022.10:g.42504679A>G, NC_000022.11:g.42108675A>G, NG_001589.4:g.535T>C, NR_034118.2:n.668-15372A>G, NR_034118.2:n.668-15373A>G, NT_187682.1:g.31020A>G, NW_003315971.2:g.31020A>G, NW_004504305.1:g.31020A>G, NW_009646207.1:g.23637A>G, NW_014040930.1:g.13394A>G, NW_014040931.1:g.2282A>G
              9.

              rs4729562 [Homo sapiens]
                TCTGCGGAAATACCTGAAATACAGC[A/G]AAAATATCCTGGACCGGCAAGGTAC
                Chromosome:
                7:99986027
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.2790/1397
                HGVS:
                NC_000007.13:g.99583650G>A, NC_000007.14:g.99986027G>A
                10.

                rs4646425 [Homo sapiens]
                  CGTTGCTTCCCTGTGTTCACACTAA[C/T]CTTTTCCTTCTTTGAAATTGGACCC
                  Chromosome:
                  15:74750940
                  Gene:
                  CYP1A2 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.0375/188
                  HGVS:
                  NC_000015.10:g.74750940C>T, NC_000015.9:g.75043281C>T, NG_008431.2:g.33399C>T, NM_000761.4:c.832-249C>T
                  11.

                  rs2859229 [Homo sapiens]
                    TGTTTGAAAGTGAGAATGAGAAACT[C/T]CAACTTGGAATTCCTAGGACAACAA
                    Chromosome:
                    1:172645877
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    T=0.4433/2220
                    HGVS:
                    NC_000001.10:g.172615017C>T, NC_000001.11:g.172645877C>T
                    12.

                    rs2859228 [Homo sapiens]
                      GGATTGAGGGTGTTTATTGGTTAGA[A/G]GTCTAGGAAGAGGCAGCTGAACCAG
                      Chromosome:
                      1:172644101
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      G=0.4415/2211
                      HGVS:
                      NC_000001.10:g.172613241A>G, NC_000001.11:g.172644101A>G
                      13.

                      rs2740566 [Homo sapiens]
                        CTGGCTCATTATCATCACTGACCCA[C/T]GTTCCATGTCTCCTTGCCCTGAGGA
                        Chromosome:
                        7:99817782
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.2258/1131
                        HGVS:
                        NC_000007.13:g.99415405G>A, NC_000007.14:g.99817782G>A
                        14.

                        rs2572023 [Homo sapiens]
                          ATGGATCTGATGCATGTCTCCACAA[C/T]CATCCTGAAGATGGCTACCAACTAC
                          Chromosome:
                          7:99876804
                          Gene:
                          OR2AE1 (GeneView)
                          Functional Consequence:
                          missense
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          A=0.4447/2227
                          HGVS:
                          NC_000007.13:g.99474427A>G, NC_000007.14:g.99876804A>G, NM_001005276.1:c.230T>C, NP_001005276.1:p.Ile77Thr
                          15.

                          rs2527927 [Homo sapiens]
                            AGAAGTAAATAGATAATCGTCACCG[C/T]ATGAAGGTCTAGAAAGACATTTAGG
                            Chromosome:
                            7:99879803
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            A=0.3405/1705
                            HGVS:
                            NC_000007.13:g.99477426G>A, NC_000007.14:g.99879803G>A
                            16.

                            rs2527894 [Homo sapiens]
                              ctcatgaactctctccttttctaaa[C/T]agatggcttggccgggcatggtggc
                              Chromosome:
                              7:99941218
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.4036/2021
                              HGVS:
                              NC_000007.13:g.99538841A>G, NC_000007.14:g.99941218A>G
                              17.

                              rs2527887 [Homo sapiens]
                                GAATTTTGGCCTCTTTTATGTCCAC[A/T]TGAATGTAAATATACTTCAGAATTT
                                Chromosome:
                                7:99953331
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                A=0.3399/1702
                                HGVS:
                                NC_000007.13:g.99550954T>A, NC_000007.14:g.99953331T>A
                                18.

                                rs2525557 [Homo sapiens]
                                  TCCAGAGATCAACTGTCTCAGCTCT[A/G]AATTTGCATATCCTGTGTGTAGACT
                                  Chromosome:
                                  7:99980576
                                  Gene:
                                  AZGP1P1 (GeneView)
                                  Functional Consequence:
                                  upstream variant 2KB
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  A=0.0298/149
                                  HGVS:
                                  NC_000007.13:g.99578199A>G, NC_000007.14:g.99980576A>G, NR_036679.1:n.-186A>G
                                  19.

                                  rs2472300 [Homo sapiens]
                                    acagggtggctataaagctaaaaca[A/G]ggatggttcgtgttaaccatgtagc
                                    Chromosome:
                                    15:74741568
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    A=0.3692/1849
                                    HGVS:
                                    NC_000015.10:g.74741568A>G, NC_000015.9:g.75033909A>G, NG_008431.2:g.24027A>G
                                    20.

                                    rs2213712 [Homo sapiens]
                                      CAAGGTGTTGGGGCAAGGAAAGAGA[C/G]TTTATTTTTTTAGGAGACTCTATTT
                                      Chromosome:
                                      1:172630738
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      G=0.2410/1207
                                      HGVS:
                                      NC_000001.10:g.172599878G>C, NC_000001.11:g.172630738G>C

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center