Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs11037575 [Homo sapiens]
    TCTGGTTTTATAGGAGAAATACTCA[C/T]TGGGTCTTGGAAAGACGACACTTCC
    Chromosome:
    11:43706780
    Gene:
    HSD17B12 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    C=0.4171/2089
    HGVS:
    CM000673.2:g.43706780T>C, NC_000011.10:g.43706780T>C, NC_000011.9:g.43728330T>C, NM_016142.2:c.160+25793T>C
    2.

    rs10055201 [Homo sapiens]
      CACTGGCTTCCTCATGGTTTTCAGC[A/G]TGCAAGTAGCAAAGATAGAAAGCCT
      Chromosome:
      5:55865274
      Gene:
      IL31RA (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.3157/1581
      HGVS:
      CM000667.2:g.55865274A>G, NC_000005.10:g.55865274A>G, NC_000005.9:g.55161102A>G, NG_029436.1:g.18896A>G, NM_001242636.1:c.98-3517A>G, NM_001242637.1:c.155-3517A>G, NM_001242638.1:c.98-3517A>G, NM_001242639.1:c.-416-1337A>G, NM_001297570.1:c.155-3517A>G, NM_001297572.1:c.-155+5675A>G, NM_139017.5:c.155-3517A>G
      3.

      rs2619046 [Homo sapiens]
        ACTGTTCAGCAAACTTAAGGAGGCC[C/T]ATTTATTGTTAATGAACAATCTTGC
        Chromosome:
        5:55801706
        Gene:
        DDX4 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        A=0.4024/2015
        HGVS:
        CM000667.2:g.55801706G>A, NC_000005.10:g.55801706G>A, NC_000005.9:g.55097534G>A, NM_001142549.1:c.1513+3135G>A, NM_001166533.1:c.1555+3135G>A, NM_001166534.1:c.1168+3135G>A, NM_024415.2:c.1615+3135G>A
        4.

        rs1027702 [Homo sapiens]
          tgatttactaggaggattcacagaa[C/T]tcagaaaagctgatatacaaagtta
          Chromosome:
          1:161743067
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
          Global MAF:
          C=0.4403/2205
          HGVS:
          CM000663.2:g.161743067C>T, NC_000001.10:g.161712857C>T

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center