Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 47

1.

rs17610514 [Homo sapiens]
    ATTAGACTACTTGACATTGCCATAG[A/G]GTTCTTGTATACTTTTGTTGCAACT
    Chromosome:
    11:56128322
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0389/195
    HGVS:
    NC_000011.10:g.56128322A>G, NC_000011.9:g.55895798A>G
    2.

    rs13423988 [Homo sapiens]
      CAACCAGCATAATTCACCACATTAA[C/T]GAATAAATAATTAGTAATTGAAGTA
      Chromosome:
      2:68684134
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3205/1605
      HGVS:
      NC_000002.11:g.68911266C>T, NC_000002.12:g.68684134C>T
      4.

      rs13401889 [Homo sapiens]
        tttgccagagctgcagctacttttg[C/T]cagaaagcctgagtatctaaggctc
        Chromosome:
        2:190045833
        Gene:
        C2orf88 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.3195/1600
        HGVS:
        NC_000002.11:g.190910559T>C, NC_000002.12:g.190045833T>C, XM_005246905.1:c.-359-34121T>C, XM_005246906.1:c.-234-34121T>C, XM_011511982.1:c.-433-34121T>C, XM_011511986.2:c.-234-34121T>C
        5.

        rs12985799 [Homo sapiens]
          ttatgtatatatgcatccttggaac[C/T]agatcaagacagttttcaagccccc
          Chromosome:
          19:19076766
          Gene:
          SLC25A42 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2025/1014
          HGVS:
          NC_000019.10:g.19076766C>T, NC_000019.9:g.19187575C>T, NG_050576.1:g.17806C>T, NM_001321544.1:c.-35+12720C>T, NM_178526.4:c.-35+12651C>T, XM_005259861.1:c.-35+594C>T, XM_005259861.3:c.-35+594C>T, XM_005259863.1:c.-35+12720C>T
          7.

          rs12046278 [Homo sapiens]
            CTGCGCCCACTCAGGCTTCCAGACC[C/T]TTCCCTGAGCCCTCCGCCCCCCGGG
            Chromosome:
            1:10739520
            Gene:
            CASZ1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4535/2271
            HGVS:
            NC_000001.10:g.10799577T>C, NC_000001.11:g.10739520T>C, NM_001079843.2:c.-77+21181A>G, NM_017766.4:c.-77+21181A>G, XM_017001540.1:c.-77+21181A>G, XM_017001541.1:c.-77+21181A>G
            8.

            rs11666627 [Homo sapiens]
              AGGATCTAGCACCCACCTCTCTTTG[C/T]CATCTCCTTTCTCTTCTCTGGGCCC
              Chromosome:
              19:19100429
              Gene:
              SLC25A42 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.2099/1051
              HGVS:
              NC_000019.10:g.19100429C>T, NC_000019.9:g.19211238C>T, NG_050576.1:g.41469C>T, NM_001321544.1:c.82-1352C>T, NM_178526.4:c.82-1352C>T, XM_005259861.1:c.82-1352C>T, XM_005259861.3:c.82-1352C>T, XM_005259862.1:c.82-1352C>T, XM_005259863.1:c.82-1352C>T, XM_011527937.2:c.82-1352C>T, XM_017026670.1:c.274-1352C>T
              9.

              rs11024074 [Homo sapiens]
                GAGGGCACCAAGGAACAATCTGCCA[C/T]TGCAGGGAAAAAAGCAAATTGTATC
                Chromosome:
                11:16895672
                Gene:
                PLEKHA7 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.2612/1308
                HGVS:
                NC_000011.10:g.16895672T>C, NC_000011.9:g.16917219T>C, NM_001329630.1:c.222-24490A>G, NM_001329631.1:c.222-24490A>G, NM_175058.4:c.222-24490A>G, XM_005252801.1:c.222-24490A>G, XM_005252802.1:c.222-24490A>G, XM_017017240.1:c.222-24490A>G, XM_017017241.1:c.222-24490A>G, XM_017017242.1:c.222-24490A>G, XM_017017243.1:c.222-24490A>G
                11.

                rs10474346 [Homo sapiens]
                  cagaagcaagcctcagaaaacagaa[C/T]ctttttctttcatcttctcctgccc
                  Chromosome:
                  5:91268322
                  Gene:
                  LOC107986433 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.3119/1562
                  HGVS:
                  NC_000005.10:g.91268322C>T, NC_000005.9:g.90564139C>T, XR_001742801.1:n.14+3407G>A
                  12.

                  rs10417974 [Homo sapiens]
                    GTCCCCACCAGGCTCAGAGCCAGAC[C/T]GCGCCTGGACCTTCTTGTTCTGACT
                    Chromosome:
                    19:19111261
                    Gene:
                    SLC25A42 (GeneView)
                    Functional Consequence:
                    utr variant 3 prime
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.2061/1032
                    HGVS:
                    NC_000019.10:g.19111261C>T, NC_000019.9:g.19222070C>T, NG_050576.1:g.52301C>T, NM_001321544.1:c.*385C>T, NM_178526.4:c.*385C>T, XM_005259861.1:c.*385C>T, XM_005259861.3:c.*385C>T, XM_005259862.1:c.*385C>T, XM_005259863.1:c.*385C>T, XM_011527937.2:c.*385C>T, XM_017026670.1:c.*385C>T
                    14.

                    rs7724489 [Homo sapiens]
                      GAAACTGCATAAGAAAAACAGAAAG[A/T]GTGAACCATTTTTGACTTATTTTAC
                      Chromosome:
                      5:91262549
                      Gene:
                      LOC107986433 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.2999/1502
                      HGVS:
                      NC_000005.10:g.91262549A>T, NC_000005.9:g.90558366A>T, XR_001742801.1:n.65+2114T>A
                      15.

                      rs7709572 [Homo sapiens]
                        AACCAGAAGTTGCAAACAGTTTATT[C/G]TTGAAAGACTGTAACAGCAGCAGGT
                        Chromosome:
                        5:91261216
                        Gene:
                        LOC107986433 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.2965/1485
                        HGVS:
                        NC_000005.10:g.91261216G>C, NC_000005.9:g.90557033G>C, XR_001742801.1:n.65+3447C>G
                        16.

                        rs7571613 [Homo sapiens]
                          gccagagaataccaaatttgttcca[A/G]atcagacacccatggatataataaa
                          Chromosome:
                          2:189940936
                          Gene:
                          C2orf88 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.1839/921
                          HGVS:
                          NC_000002.11:g.190805662A>G, NC_000002.12:g.189940936A>G, XM_005246905.1:c.-360+61109A>G, XM_005246906.1:c.-235+61109A>G, XM_011511982.1:c.-434+61109A>G, XM_011511986.2:c.-235+61109A>G
                          17.

                          rs7016759 [Homo sapiens]
                            GGTCAGGCCCTGGTGCGGGCTTTCT[C/T]CGGGAATGCAGACTGTGGGCTTCCC
                            Chromosome:
                            8:48499856
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.2853/1429
                            HGVS:
                            NC_000008.10:g.49412416T>C, NC_000008.11:g.48499856T>C
                            18.

                            rs6511018 [Homo sapiens]
                              tcccctgaagaaagaggacttctcc[A/G]gcccgatggttccctcaaaagtccc
                              Chromosome:
                              19:19075896
                              Gene:
                              SLC25A42 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.2103/1053
                              HGVS:
                              NC_000019.10:g.19075896G>A, NC_000019.9:g.19186705G>A, NG_050576.1:g.16936G>A, NM_001321544.1:c.-35+11850G>A, NM_178526.4:c.-35+11781G>A, XM_005259861.1:c.-311G>A, XM_005259861.3:c.-162-149G>A, XM_005259863.1:c.-35+11850G>A
                              19.

                              rs6495122 [Homo sapiens]
                                GGCAGAGATGGTTGCCTGTCCCACC[A/C]CCTTTCACCCTCAGGGGCTCTGGTT
                                Chromosome:
                                15:74833304
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.2949/1477
                                HGVS:
                                NC_000015.10:g.74833304A>C, NC_000015.9:g.75125645A>C
                                20.

                                rs4930130 [Homo sapiens]
                                  AAAGGATGTAGCCTATGAAGTCTCC[A/G]CTTTTTTTAAAATGAAGATTTTCTT
                                  Chromosome:
                                  11:2598400
                                  Gene:
                                  KCNQ1 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  G=0.2949/1477
                                  HGVS:
                                  NC_000011.10:g.2598400A>G, NC_000011.9:g.2619630A>G, NG_008935.1:g.158410A>G, NM_000218.2:c.1393+9546A>G, NM_181798.1:c.1012+9546A>G, NR_040711.2:n.1286+9546A>G

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center