Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 24

1.

rs41388848 [Homo sapiens]
    AGCCCTCATATGGATTTGAGATTCC[C/T]ATTTATACTTCTTATAAGATTTAGT
    Chromosome:
    12:6099452
    Gene:
    VWF (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0905/453
    HGVS:
    NC_000012.11:g.6208618T>C, NC_000012.12:g.6099452T>C, NG_009072.1:g.30219A>G, NM_000552.3:c.533-3868A>G, NM_000552.4:c.533-3868A>G
    2.

    rs12304995 [Homo sapiens]
      TACTGATAATGCATCATTTCTAACA[C/T]TGGTGGACAAGCAAAGAATATTCAC
      Chromosome:
      12:6055289
      Gene:
      VWF (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3584/1795
      HGVS:
      NC_000012.11:g.6164455C>T, NC_000012.12:g.6055289C>T, NG_009072.1:g.74382G>A, NM_000552.3:c.1945+1568G>A, NM_000552.4:c.1945+1568G>A
      3.

      rs11614912 [Homo sapiens]
        CCCCATTGTCCCCAACTCTCCATAC[A/G]TGAACACCATCGTGACCCACTCTCC
        Chromosome:
        12:6039389
        Gene:
        VWF (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1018/510
        HGVS:
        NC_000012.11:g.6148555A>G, NC_000012.12:g.6039389A>G, NG_009072.1:g.90282T>C, NM_000552.3:c.2443-2898T>C, NM_000552.4:c.2443-2898T>C
        4.

        rs11612401 [Homo sapiens]
          gttgttttaagctatcaagtttttg[C/G]tgatttgttatagcagcaataaaaa
          Chromosome:
          12:6027802
          Gene:
          VWF (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1288/645
          HGVS:
          NC_000012.11:g.6136968G>C, NC_000012.12:g.6027802G>C, NG_009072.1:g.101869C>G, NM_000552.3:c.2967+1540C>G, NM_000552.4:c.2967+1540C>G
          5.

          rs11610629 [Homo sapiens]
            GCTGGCCCATGACTCAATGATAAGG[A/C]AACACCCTAGAATAGTCTGCAGTGT
            Chromosome:
            12:6028290
            Gene:
            VWF (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.1791/897
            HGVS:
            NC_000012.11:g.6137456A>C, NC_000012.12:g.6028290A>C, NG_009072.1:g.101381T>G, NM_000552.3:c.2967+1052T>G, NM_000552.4:c.2967+1052T>G
            6.

            rs11609815 [Homo sapiens]
              AGAGAGACAACTGCACTTAACCTTG[C/G/T]GGAATTCCTCCTTGTCATTAGAGAT
              Chromosome:
              12:6025065
              Gene:
              VWF (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2216/1110
              HGVS:
              NC_000012.11:g.6134231C>G, NC_000012.12:g.6025065C>G, NC_000012.12:g.6025065C>T, NG_009072.1:g.104606G>A, NG_009072.1:g.104606G>C, NM_000552.3:c.3222+515G>A, NM_000552.3:c.3222+515G>C, NM_000552.4:c.3222+515G>A, NM_000552.4:c.3222+515G>C
              7.

              rs11609728 [Homo sapiens]
                ACAGCACTCCACATAGTCAAAGCAG[A/C]GGATCCAAAACTGTGGCCTGGGGAT
                Chromosome:
                12:6030526
                Gene:
                VWF (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.1156/579
                HGVS:
                NC_000012.11:g.6139692C>A, NC_000012.12:g.6030526C>A, NG_009072.1:g.99145G>T, NM_000552.3:c.2820+918G>T, NM_000552.4:c.2820+918G>T
                8.

                rs11063995 [Homo sapiens]
                  aagaaaaggtgctatacttttacaa[C/T]atacttagagccctgatgttgagac
                  Chromosome:
                  12:6026987
                  Gene:
                  VWF (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.2210/1107
                  HGVS:
                  NC_000012.11:g.6136153T>C, NC_000012.12:g.6026987T>C, NG_009072.1:g.102684A>G, NM_000552.3:c.2968-941A>G, NM_000552.4:c.2968-941A>G
                  9.

                  rs10638570 [Homo sapiens]
                    CACGCTTCTGAATGAAGTGCAGACG[-/CT]CTCTGGGGAGCCAGGAAGGGAAGCG
                    Chromosome:
                    2:1968289
                    Gene:
                    MYT1L (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster
                    HGVS:
                    NC_000002.11:g.1972061_1972062insAG, NC_000002.12:g.1968289_1968290insAG, NG_051313.1:g.368099_368100insCT, NM_001303052.1:c.152+10875_152+10876insCT, NM_001329844.1:c.152+10875_152+10876insCT, NM_001329845.1:c.152+10875_152+10876insCT, NM_001329846.1:c.152+10875_152+10876insCT, NM_001329847.1:c.152+10875_152+10876insCT, NM_001329848.1:c.152+10875_152+10876insCT, NM_001329849.1:c.152+10875_152+10876insCT, NM_001329851.1:c.152+10875_152+10876insCT, NM_001329852.1:c.152+10875_152+10876insCT, NM_015025.3:c.152+10875_152+10876insCT, XM_005264685.1:c.152+10875_152+10876insCT, XM_011510318.1:c.152+10875_152+10876insCT, XM_011510319.1:c.152+10875_152+10876insCT, XM_011510320.2:c.152+10875_152+10876insCT, XM_011510321.2:c.152+10875_152+10876insCT, XM_011510322.2:c.152+10875_152+10876insCT, XM_011510323.1:c.152+10875_152+10876insCT, XM_011510324.1:c.152+10875_152+10876insCT, XM_011510325.1:c.152+10875_152+10876insCT, XM_011510326.1:c.152+10875_152+10876insCT, XM_011510327.1:c.152+10875_152+10876insCT, XM_011510328.2:c.152+10875_152+10876insCT, XM_011510331.2:c.152+10875_152+10876insCT, XM_011510332.2:c.152+10875_152+10876insCT, XM_017003604.1:c.152+10875_152+10876insCT, XM_017003605.1:c.152+10875_152+10876insCT, XM_017003606.1:c.152+10875_152+10876insCT, XM_017003607.1:c.152+10875_152+10876insCT, XM_017003608.1:c.152+10875_152+10876insCT, XM_017003609.1:c.152+10875_152+10876insCT, XM_017003610.1:c.152+10875_152+10876insCT, XM_017003611.1:c.152+10875_152+10876insCT, XM_017003612.1:c.152+10875_152+10876insCT, XM_017003613.1:c.152+10875_152+10876insCT, XM_017003614.1:c.152+10875_152+10876insCT, XM_017003615.1:c.152+10875_152+10876insCT, XM_017003616.1:c.152+10875_152+10876insCT, XM_017003617.1:c.152+10875_152+10876insCT, XM_017003618.1:c.152+10875_152+10876insCT, XM_017003619.1:c.152+10875_152+10876insCT, XM_017003621.1:c.152+10875_152+10876insCT, XM_017003622.1:c.152+10875_152+10876insCT
                    11.

                    rs8176704 [Homo sapiens]
                      ACATGTTCTGAAACTCCACTCTGCC[C/T]GGCCTTGGCTTCGACGTGTCTGGTG
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.0463/232
                      HGVS:
                      NC_000009.11:g.136135552G>A, NG_006669.1:g.17502C>T, NM_020469.2:c.156-282C>T, XM_005276848.1:c.156-282C>T, XM_005276849.1:c.99-282C>T, XM_005276850.1:c.-188-282C>T, XM_005276851.1:c.-133-282C>T, XM_005276852.1:c.-86+1170C>T
                      12.

                      rs7139057 [Homo sapiens]
                        AGTGTCACTTAGCGACACTCACTAT[G/T]TGAAATAAACCTCTGGTCAGTGACA
                        Chromosome:
                        12:6060157
                        Gene:
                        VWF (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.1116/559
                        HGVS:
                        NC_000012.11:g.6169323T>G, NC_000012.12:g.6060157T>G, NG_009072.1:g.69514A>C, NM_000552.3:c.1534-2113A>C, NM_000552.4:c.1534-2113A>C
                        13.

                        rs2854871 [Homo sapiens]
                          ATTCCCTCTTTGAGACCATTGAGCT[A/G]CATTTCTCCTTCTACCTGGACCCCC
                          Chromosome:
                          12:6023913
                          Gene:
                          VWF (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.1162/582
                          HGVS:
                          NC_000012.11:g.6133079T>C, NC_000012.12:g.6023913T>C, NG_009072.1:g.105758A>G, NM_000552.3:c.3223-126A>G, NM_000552.4:c.3223-126A>G
                          14.

                          rs2239161 [Homo sapiens]
                            GTGCAGCCCATTTCGCTGTGGTAGG[C/T]ATGAGTGTCCCTCCTCTTTGGGACC
                            Chromosome:
                            12:6053495
                            Gene:
                            VWF (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.1174/588
                            HGVS:
                            NC_000012.11:g.6162661G>A, NC_000012.12:g.6053495G>A, NG_009072.1:g.76176C>T, NM_000552.3:c.1946-712C>T, NM_000552.4:c.1946-712C>T
                            15.

                            rs2239160 [Homo sapiens]
                              GCGTTGCCACTTTGCTACACTTCCT[C/T]CTGGCTTGTGTCTCTTGCAGTATTT
                              Chromosome:
                              12:6053588
                              Gene:
                              VWF (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.1468/735
                              HGVS:
                              NC_000012.11:g.6162754A>G, NC_000012.12:g.6053588A>G, NG_009072.1:g.76083T>C, NM_000552.3:c.1946-805T>C, NM_000552.4:c.1946-805T>C
                              16.

                              rs1800380 [Homo sapiens]
                                ACTTTGAGGTGGTGGAGTCTGGCCG[A/G]TACATCATTCTGCTGCTGGGCAAAG
                                Chromosome:
                                12:6029429
                                Gene:
                                VWF (GeneView)
                                Functional Consequence:
                                synonymous codon
                                Clinical significance:
                                Likely benign
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.1791/897
                                HGVS:
                                NC_000012.11:g.6138595C>T, NC_000012.12:g.6029429C>T, NG_009072.1:g.100242G>A, NM_000552.3:c.2880G>A, NM_000552.4:c.2880G>A, NP_000543.2:p.Arg960
                                17.

                                rs1063857 [Homo sapiens]
                                  AGTGTACCAAAACGTGCCAGAACTA[C/T]GACCTGGAGTGCATGAGCATGGGCT
                                  Chromosome:
                                  12:6044348
                                  Gene:
                                  VWF (GeneView)
                                  Functional Consequence:
                                  synonymous codon
                                  Clinical significance:
                                  Likely benign
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  G=0.3365/1685
                                  HGVS:
                                  NC_000012.11:g.6153514A>G, NC_000012.12:g.6044348A>G, NG_009072.1:g.85323T>C, NM_000552.3:c.2385T>C, NM_000552.4:c.2385T>C, NP_000543.2:p.Tyr795
                                  18.

                                  rs514659 [Homo sapiens]
                                    ttagcacccttatcaaaaagcaact[A/C]ttaaaaaatcaattgactatttctg
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    C=0.3858/1932
                                    HGVS:
                                    NC_000009.11:g.136142203A>C, NG_006669.1:g.10845T>G, NM_020469.2:c.29-4636T>G, XM_005276848.1:c.29-4622T>G, XM_005276849.1:c.-30+2351T>G, XM_005276851.1:c.-260-4622T>G
                                    20.

                                    rs216318 [Homo sapiens]
                                      CCCTGCCAGTGCTGTACCCTGGAGG[A/C]CCATTTCAGCATGTGTGGCGGACTC
                                      Chromosome:
                                      12:6030095
                                      Gene:
                                      VWF (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by cluster,by frequency,by hapmap,by submitter
                                      Global MAF:
                                      A=0.0996/499
                                      HGVS:
                                      NC_000012.11:g.6139261A>C, NC_000012.12:g.6030095A>C, NG_009072.1:g.99576T>G, NM_000552.3:c.2821-607T>G, NM_000552.4:c.2821-607T>G

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center