Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

2.

rs9904761 [Homo sapiens]
    tctggggcaataggggaggtcatca[C/G]agggaaggtggcattcaagatgggc
    Chromosome:
    17:48879468
    Gene:
    LOC105371814 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2849/1427
    HGVS:
    NC_000017.10:g.46956830C>G, NC_000017.11:g.48879468C>G, NR_135674.1:n.477-123G>C
    4.

    rs3895874 [Homo sapiens]
      GTTCTTTCCAGGCTCCTCCTCTGCC[A/G]CCGCCATGGGTACTTGGGACCATAA
      Chromosome:
      17:48970506
      Gene:
      GIP (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4615/2311
      HGVS:
      NC_000017.10:g.47047868G>A, NC_000017.11:g.48970506G>A, NM_004123.2:c.-2011C>T
      5.

      rs3848460 [Homo sapiens]
        AAATAAAAAAGGGTACTTGTAGTGA[A/G]GACAGACTTGGGGTAGGGTGGCACT
        Chromosome:
        17:48969752
        Gene:
        GIP (GeneView)
        Functional Consequence:
        upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.4637/2322
        HGVS:
        NC_000017.10:g.47047114A>G, NC_000017.11:g.48969752A>G, NM_004123.2:c.-1257T>C
        6.

        rs3809770 [Homo sapiens]
          TCTCTATTATACAGGAGCCACTCCA[A/G]GGCAGGGGCTTTCTGTCCCTGATCT
          Chromosome:
          17:48970234
          Gene:
          GIP (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.3055/1530
          HGVS:
          NC_000017.10:g.47047596A>G, NC_000017.11:g.48970234A>G, NM_004123.2:c.-1739T>C
          7.

          rs2920502 [Homo sapiens]
            AGCCACCGGCTTTCCCGCGTCCACT[C/G]TCTGCCCCGCGGCAGGCTACCTGGT
            Chromosome:
            3:12287696
            Gene:
            PPARG (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4054/2030
            HGVS:
            NC_000003.11:g.12329195G>C, NC_000003.12:g.12287696G>C, NG_011749.1:g.4847G>C, NM_005037.5:c.-327G>C, NM_138711.3:c.-1515G>C, NM_138712.3:c.-401G>C, XM_011533841.2:c.-1441G>C, XM_011533844.1:c.-1515G>C
            8.

            rs2839670 [Homo sapiens]
              TTTTGTAGAAAGGAAATCATCAGAA[A/C]GATTCTGACTTTCTCCTCCTTTCTT
              Chromosome:
              10:26215411
              Gene:
              GAD2 (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.3768/1887
              HGVS:
              NC_000010.10:g.26504340C>A, NC_000010.11:g.26215411C>A, NM_000818.2:c.-1399C>A, NM_001134366.1:c.-1399C>A
              9.

              rs2291725 [Homo sapiens]
                TCCTCCTCCTTCCTATTAGCTTGAC[C/T]GGCCAGCTCCAGCGCCCGAGCCTCC
                Chromosome:
                17:48961770
                Gene:
                GIP (GeneView)
                Functional Consequence:
                missense
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.4225/2116
                HGVS:
                NC_000017.10:g.47039132T>C, NC_000017.11:g.48961770T>C, NM_004123.2:c.307A>G, NP_004114.1:p.Ser103Gly
                11.

                rs1325471 [Homo sapiens]
                  AGGACTGAAGAGGAGTATTAAAATA[C/T]GAGTTACTTTGCTCATCATTTATTT
                  Chromosome:
                  6:83857956
                  Gene:
                  CYB5R4 (GeneView) RIPPLY2 (GeneView)
                  Functional Consequence:
                  downstream variant 500B,upstream variant 2KB
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.3369/1687
                  HGVS:
                  NC_000006.11:g.84567675A>G, NC_000006.12:g.83857956A>G, NG_046722.1:g.9691A>G, NM_001009994.2:c.*567A>G, NM_016230.3:c.-1827A>G, NR_103525.1:n.1011A>G
                  12.

                  rs937301 [Homo sapiens]
                    attcatcgcgcctggccTACAAGTA[C/T]CCCTTCTAACTGAGGGCAACTGTAA
                    Chromosome:
                    17:48968914
                    Gene:
                    GIP (GeneView)
                    Functional Consequence:
                    upstream variant 2KB
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.4641/2324
                    HGVS:
                    NC_000017.10:g.47046276A>G, NC_000017.11:g.48968914A>G, NM_004123.2:c.-419T>C

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center