Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 95

1.

rs41310927 [Homo sapiens]
    TACTGCCTATACATTCTGTAGGTGC[C/T]TTGTATTACGATAGAAGCTTTGTGT
    Chromosome:
    1:197101567
    Gene:
    ASPM (GeneView)
    Functional Consequence:
    intron variant,missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Benign
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.2143/1073
    HGVS:
    NC_000001.10:g.197070697T>C, NC_000001.11:g.197101567T>C, NG_015867.1:g.50128A>G, NM_001206846.1:c.4066-5403A>G, NM_018136.4:c.7684A>G, NP_060606.3:p.Ser2562Gly
    2.

    rs36004306 [Homo sapiens]
      CTGCTTGTTAGCATTCTTCACAGCC[A/C/G]GGTAAAGTTTATAGGCTCTTTGAAT
      Chromosome:
      1:197091956
      Gene:
      ASPM (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)/C(germline)
      Clinical significance:
      Uncertain significance
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.0150/75
      HGVS:
      NC_000001.10:g.197061086A>C, NC_000001.10:g.197061086A>G, NC_000001.11:g.197091956A>C, NC_000001.11:g.197091956A>G, NG_015867.1:g.59739T>C, NG_015867.1:g.59739T>G, NM_001206846.1:c.4640T>C, NM_001206846.1:c.4640T>G, NM_018136.4:c.9395T>C, NM_018136.4:c.9395T>G, NP_001193775.1:p.Leu1547Arg, NP_001193775.1:p.Leu1547Pro, NP_060606.3:p.Leu3132Arg, NP_060606.3:p.Leu3132Pro
      5.

      rs17570753 [Homo sapiens]
        TAGAATGAACCTTTGAGAAGGGAGG[A/T]AGCAGTGCATTGTATAGGAATTGGC
        Chromosome:
        8:6644838
        Gene:
        MCPH1-AS1 (GeneView) MCPH1 (GeneView)
        Functional Consequence:
        intron variant,nc transcript variant,utr variant 3 prime
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0449/225
        HGVS:
        NC_000008.10:g.6502359T>A, NC_000008.11:g.6644838T>A, NG_016619.2:g.243247T>A, NM_001322042.1:c.*1811T>A, NM_024596.4:c.*1789T>A, NR_125386.1:n.70-17528A>T, XM_017013833.1:c.*1764T>A, XR_001745596.1:n.4532T>A
        8.

        rs17550662 [Homo sapiens]
          TCAAACTGGACTGTGCCACAGCGAT[A/G]ATGGGTTTTGTCCTTTTGTTTGTTT
          Chromosome:
          1:197139816
          Gene:
          ASPM (GeneView)
          Functional Consequence:
          synonymous codon
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          Likely benign
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.0192/96
          HGVS:
          NC_000001.10:g.197108946A>G, NC_000001.11:g.197139816A>G, NG_015867.1:g.11879T>C, NM_001206846.1:c.1977T>C, NM_018136.4:c.1977T>C, NP_001193775.1:p.Ile659, NP_060606.3:p.Ile659
          9.

          rs17402892 [Homo sapiens]
            AGTTCATTTCCCAAGTGTGAATCTG[A/C]CTTTGGTTTTGGTTTCAAAGAAGGA
            Chromosome:
            13:24905403
            Gene:
            CENPJ (GeneView)
            Functional Consequence:
            missense,nc transcript variant
            Allele Origin:
            A(germline)/C(germline)
            Clinical significance:
            Likely benign
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.0611/306
            HGVS:
            NC_000013.10:g.25479541A>C, NC_000013.11:g.24905403A>C, NG_009165.2:g.22545T>G, NM_018451.4:c.2635T>G, NP_060921.3:p.Ser879Ala, NR_047594.1:n.2830T>G, NR_047595.1:n.2830T>G, XM_011535149.2:c.2635T>G, XM_011535150.2:c.2635T>G, XM_017020673.1:c.2635T>G, XP_011533451.1:p.Ser879Ala, XP_011533452.1:p.Ser879Ala, XP_016876162.1:p.Ser879Ala, XR_941627.1:n.2830T>G, XR_941628.1:n.2830T>G
            14.

            rs12871627 [Homo sapiens]
              GAATGAAATATCCCAAAATGGCATA[C/G]CAGTTACTTTTGGGTAGTTAAGTTG
              Chromosome:
              13:24904650
              Gene:
              CENPJ (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.3211/1608
              HGVS:
              NC_000013.10:g.25478788G>C, NC_000013.11:g.24904650G>C, NG_009165.2:g.23298C>G, NM_018451.4:c.2693-592C>G, NR_047594.1:n.2888-592C>G, NR_047595.1:n.2888-592C>G, XM_011535149.2:c.2693-592C>G, XM_011535150.2:c.2693-592C>G, XM_017020673.1:c.2693-592C>G, XR_941627.1:n.2888-592C>G, XR_941628.1:n.2888-592C>G
              15.

              rs12864973 [Homo sapiens]
                CAAAGATCATACAGAGATTGTATGC[C/T]GCCTTTTGCTGAATCTCTGAACGAG
                Chromosome:
                13:24885132
                Gene:
                CENPJ (GeneView) RNF17 (GeneView)
                Functional Consequence:
                downstream variant 500B,intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.1410/706
                HGVS:
                NC_000013.10:g.25459270C>T, NC_000013.11:g.24885132C>T, NG_009165.2:g.42816G>A, NM_018451.4:c.3477+144G>A, NR_047594.1:n.3789+144G>A, NR_047595.1:n.3587+144G>A, XM_011535149.2:c.*581G>A, XM_011535156.2:c.*11-2982C>T, XR_941627.1:n.3672+144G>A
                19.

                rs12116571 [Homo sapiens]
                  GTCATAATAAAAGTTTGAGCCACTC[C/T]ATTAATAGATTTATATGAATTATAA
                  Chromosome:
                  1:197119863
                  Gene:
                  ASPM (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.0427/214
                  HGVS:
                  NC_000001.10:g.197088993C>T, NC_000001.11:g.197119863C>T, NG_015867.1:g.31832G>A, NM_001206846.1:c.3871-1880G>A, NM_018136.4:c.3871-1880G>A
                  20.

                  rs12085377 [Homo sapiens]
                    aaaaactcaagctggaaactgttta[A/G]ggcaaacctgtctcccattctattc
                    Chromosome:
                    1:197112552
                    Gene:
                    ASPM (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.2993/1499
                    HGVS:
                    NC_000001.10:g.197081682G>A, NC_000001.11:g.197112552G>A, NG_015867.1:g.39143C>T, NM_001206846.1:c.4065+5237C>T, NM_018136.4:c.4065+5237C>T

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center