Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 13

1.

rs41530251 [Homo sapiens]
  • Suspected
TTCCCGAAGACAAGAACAGATAACA[C/T]TGGATACAGCATTATCCAGTAGCCG
Chromosome:
19:40810450
Gene:
CYP2T1P (GeneView)
Functional Consequence:
nc transcript variant
Validated:
by 1000G,by cluster,by frequency,by hapmap
Global MAF:
C=0.3179/1592
HGVS:
NC_000019.10:g.40810450T>C, NC_000019.9:g.41316355T>C, NG_029340.1:g.1043A>G, NR_144551.1:n.562A>G
2.

rs10419393 [Homo sapiens]
    ATGGGTGTCCCCCACAACATCATCC[A/G]GGACACTCAGTTTCGAGGTTACCTT
    Chromosome:
    19:40898291
    Gene:
    CYP2G1P (GeneView) LOC107985299 (GeneView)
    Functional Consequence:
    intron variant,nc transcript variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4399/2203
    HGVS:
    NC_000019.10:g.40898291A>G, NC_000019.9:g.41404196A>G, NR_040249.1:n.1800A>G, XR_001753940.1:n.618-4208T>C
    4.

    rs8103444 [Homo sapiens]
      CTTGGAATTTATCGAATCCAGGTCC[A/C]TTATTTTGGAGATGCAGACAGTAAC
      Chromosome:
      19:40891756
      Gene:
      CYP2G1P (GeneView)
      Functional Consequence:
      nc transcript variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.2302/1153
      HGVS:
      NC_000019.10:g.40891756C>A, NC_000019.9:g.41397661C>A, NR_040249.1:n.931C>A
      5.

      rs7259265 [Homo sapiens]
        AATTTCCCATCAAAACTTGTAAAAT[G/T]GCTCGTTTGATGAGGAGAATGAGCA
        Chromosome:
        19:40659347
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2065/1034
        HGVS:
        NC_000019.10:g.40659347T>G, NC_000019.9:g.41165252T>G
        6.

        rs7251418 [Homo sapiens]
          CCTACACATTTAATCCTCTATACTA[A/G]CTCTCATACCCACTTACCACTCCCT
          Chromosome:
          19:40835684
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2286/1145
          HGVS:
          NC_000019.10:g.40835684A>G, NC_000019.9:g.41341589A>G
          7.

          rs3897584 [Homo sapiens]
            TCCCTCCTACATGGCCAAGTACTGA[C/G]GATAGAGCAGAGAACAAGATTCCTG
            Chromosome:
            11:113379003
            Gene:
            TTC12 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.3444/1725
            HGVS:
            NC_000011.10:g.113379003G>C, NC_000011.9:g.113249725G>C, XM_017017948.1:c.2271+5826G>C
            8.

            rs2607414 [Homo sapiens]
              CAAGTAATTATACAAGTGTAGCTGT[A/G]CCTAGACTCTTCATCCTGTCCCCTT
              Chromosome:
              19:40761224
              Gene:
              SNRPA (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.2478/1241
              HGVS:
              NC_000019.10:g.40761224T>C, NC_000019.9:g.41267129T>C, NM_004596.4:c.426+1614T>C, XM_005259179.1:c.189+1614T>C
              9.

              rs2561543 [Homo sapiens]
                GGTATCTGTTTGCTCACCTTGAATC[C/T]GCTGCCCCCAGCCCAGAGACTGCCC
                Chromosome:
                19:40681534
                Gene:
                NUMBL (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.3139/1572
                HGVS:
                NC_000019.10:g.40681534A>G, NC_000019.9:g.41187439A>G, NM_001289979.1:c.277-477T>C, NM_001289980.1:c.277-477T>C, NM_001289980.2:c.277-477T>C, NM_004756.4:c.400-477T>C, XM_005259408.1:c.400-477T>C
                10.

                rs2561528 [Homo sapiens]
                  AAGTTAGGAACAGATCTACACACTG[C/G]AGGGTTTAAACGATGGGTTTGAAAC
                  Chromosome:
                  19:40720510
                  Gene:
                  ITPKC (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.3123/1564
                  HGVS:
                  NC_000019.10:g.40720510C>G, NC_000019.9:g.41226415C>G, NG_012970.1:g.8408C>G, NG_027800.1:g.1376G>C, NM_025194.2:c.1155+2220C>G, XM_017027324.1:c.306+2220C>G, XR_243961.1:n.1311+2220C>G
                  11.

                  rs2471854 [Homo sapiens]
                    CTACATTGTACTCATAATTTTAAAT[C/G]CTAGACTAGTGCCTGTAATCCCAGC
                    Chromosome:
                    11:113428917
                    Gene:
                    DRD2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.2608/1306
                    HGVS:
                    NC_000011.10:g.113428917G>C, NC_000011.9:g.113299639G>C, NG_008841.1:g.51363C>G, NM_000795.3:c.-31-4235C>G, NM_016574.3:c.-31-4235C>G, XM_005271425.1:c.-31-4235C>G, XM_017017296.1:c.-31-4235C>G
                    12.

                    rs1801272 [Homo sapiens]
                      GAGGCGGGCTTCCTCATCGACGCCC[A/T]CCGGGGCACTGGCGGTGAGCAGGGG
                      Chromosome:
                      19:40848628
                      Gene:
                      CYP2A6 (GeneView)
                      Functional Consequence:
                      missense
                      Allele Origin:
                      T(germline)/A(germline)
                      Clinical significance:
                      drug-response
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.0092/46
                      HGVS:
                      NC_000019.10:g.40848628A>T, NC_000019.9:g.41354533A>T, NG_008377.1:g.6820T>A, NM_000762.5:c.479T>A, NP_000753.3:p.Leu160His, XM_005258568.1:c.326T>A, XP_005258625.1:p.Leu109His
                      13.

                      rs1125394 [Homo sapiens]
                        GGAAGTCATGTGCTTTGTATGAAAC[A/G]CCTTGGAATGCTGATAAGTTTAATT
                        Chromosome:
                        11:113426463
                        Gene:
                        DRD2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        C=0.2652/1328
                        HGVS:
                        NC_000011.10:g.113426463T>C, NC_000011.9:g.113297185T>C, NG_008841.1:g.53817A>G, NM_000795.3:c.-31-1781A>G, NM_016574.3:c.-31-1781A>G, XM_005271425.1:c.-31-1781A>G, XM_005271426.1:c.-1812A>G, XM_017017296.1:c.-31-1781A>G

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center