Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 14

1.

rs17335275 [Homo sapiens]
    AGACAGATATTAGGATATGGGTGGA[A/G]GTAGATGTTAATATGTAGGTGTAGA
    Chromosome:
    X:3656497
    Gene:
    PRKX (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.3902/1473
    HGVS:
    NC_000023.10:g.3574538A>G, NC_000023.11:g.3656497A>G, NG_016716.1:g.62138T>C, NM_005044.4:c.336-1085T>C, XM_005274560.1:c.336-1085T>C, XM_005274561.1:c.336-1085T>C
    2.

    rs16895338 [Homo sapiens]
      CCTAGAAAGGAATTAGTGGAAGATG[C/T]ATAAACATTTTAAATTCAAATGCAG
      Chromosome:
      6:64500697
      Gene:
      EYS (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2400/1202
      HGVS:
      NC_000006.11:g.65210590C>T, NC_000006.12:g.64500697C>T, NG_023443.2:g.1211529G>A, NM_001142800.1:c.5645-61345G>A, NM_001292009.1:c.5645-61345G>A
      3.

      rs12032381 [Homo sapiens]
        AAAGAGCGAGACTCCGTCCCCCCCC[A/C]AAAAAAATTAGATCAGTCATTTCCC
        Chromosome:
        1:221443734
        Gene:
        LOC105372932 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        C=0.2059/1031
        HGVS:
        NC_000001.10:g.221617076A>C, NC_000001.11:g.221443734A>C, XR_922621.2:n.623-26408A>C
        4.

        rs11649669 [Homo sapiens]
          GGAGTCACAGATGCCAGTGTTTTAG[A/G]TAAACTTCAGACATGCTTCTGATGT
          Chromosome:
          16:5303564
          Gene:
          RBFOX1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.3546/1776
          HGVS:
          NC_000016.10:g.5303564A>G, NC_000016.9:g.5353565A>G, XM_005255378.1:c.219+63459A>G, XM_017023318.1:c.339+63459A>G, XM_017023319.1:c.339+63459A>G
          5.

          rs7426655 [Homo sapiens]
            atttctccctctccacagcccctgg[A/C]tgctttcaatgcttgtgggtatatt
            Chromosome:
            3:196618278
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.1242/622
            HGVS:
            NC_000003.11:g.196345149A>C, NC_000003.12:g.196618278A>C
            6.

            rs6897647 [Homo sapiens]
              AATTGTAGTTAATGGCTTTCTTTTT[A/G]TGTAACTTTTGGAGAGTACTTTTTT
              Chromosome:
              5:15903915
              Gene:
              FBXL7 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.2652/1328
              HGVS:
              NC_000005.10:g.15903915A>G, NC_000005.9:g.15904024A>G, NM_001278317.1:c.-14-23975A>G, NM_012304.4:c.128-23975A>G, XM_005248273.1:c.113-23975A>G, XM_011513998.1:c.-14-23975A>G, XM_017009262.1:c.113-23975A>G
              7.

              rs6590281 [Homo sapiens]
                TTGGCAAGGCACAGCGCACTATTGA[A/G]ATCATCCTGTATCTTCGGGTCTCGG
                Chromosome:
                11:127849643
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.2616/1310
                HGVS:
                NC_000011.10:g.127849643G>A, NC_000011.9:g.127719538G>A
                8.

                rs4864039 [Homo sapiens]
                  TGCTCTGGATATGAAGCATAAATTA[A/G]AAAGATTACTCAATTGATCTTGTAG
                  Chromosome:
                  4:131384419
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.3978/1992
                  HGVS:
                  NC_000004.11:g.132305574G>A, NC_000004.12:g.131384419G>A
                  11.

                  rs2846236 [Homo sapiens]
                    TCCAGGCTGTGTTTCTAATTTCTAC[A/G]TATGTTATACTTCACATATGCTGAA
                    Chromosome:
                    11:124195920
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.4603/2305
                    HGVS:
                    NC_000011.10:g.124195920G>A, NC_000011.9:g.124066627G>A
                    12.

                    rs1978136 [Homo sapiens]
                      TAAGCTGCTTGAGGTTCGGGTGATG[G/T]ATTCAGAGTTGCTTCTTCCTTTCAT
                      Chromosome:
                      17:34050679
                      Gene:
                      ASIC2 (GeneView) LOC107987247 (GeneView)
                      Functional Consequence:
                      intron variant,utr variant 3 prime
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      C=0.3482/1744
                      HGVS:
                      NC_000017.10:g.32377698A>C, NC_000017.11:g.34050679A>C, NG_029763.1:g.111128T>G, NM_001094.4:c.555+105299T>G, XM_017025499.1:c.*1328T>G
                      13.

                      rs1919060 [Homo sapiens]
                      • Suspected
                      GCAGAAATGGTGCCATGAGGGCACA[C/T]TGACTGGTCTCTAGTGCACATGGCT
                      Chromosome:
                      16:5268655
                      Gene:
                      RBFOX1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.1506/754
                      HGVS:
                      NC_000016.10:g.5268655A>G, NC_000016.9:g.5318656A>G, XM_005255378.1:c.219+28550A>G, XM_017023318.1:c.339+28550A>G, XM_017023319.1:c.339+28550A>G
                      14.

                      rs1903138 [Homo sapiens]
                        CCTCATCCGATACATAGAAGGCATA[A/C]ATAGAACTAAAAGGCTGAGTAAGGG
                        Chromosome:
                        1:221479161
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.2113/1058
                        HGVS:
                        NC_000001.10:g.221652503T>G, NC_000001.11:g.221479161T>G

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center