Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs143383 [Homo sapiens]
    AGTTGTGCAGGAGAAAGGGGGCGGT[C/T]GGCTTTCTCCTTTCAAGAACGAGTT
    Chromosome:
    20:35438203
    Gene:
    GDF5 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4535/2271
    HGVS:
    NC_000020.10:g.34025983A>G, NC_000020.11:g.35438203G, NC_000020.11:g.35438203G>A, NG_008076.3:g.21544C, NG_008076.3:g.21544C>T, NM_000557.3:c.-275C, NM_000557.3:c.-275C>T, NM_000557.4:c.-275C, NM_000557.4:c.-275C>T, NM_000557.4:c.-275T>C, NM_001319138.1:c.-241-34C, NM_001319138.1:c.-241-34C>T, NM_001319138.1:c.-241-34T>C, XM_011529075.2:c.-241-34C, XM_011529075.2:c.-241-34C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center