Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs10426843 [Homo sapiens]
    GAGTTCAAGTGATTCTCATGCCTCA[C/G/T]CCTCCTGAGTAGCTGGGACTAAAGG
    Chromosome:
    19:15172784
    Gene:
    NOTCH3 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    G=0.1312/657
    HGVS:
    CM000681.2:g.15172784G>C, CM000681.2:g.15172784G>T, NC_000019.10:g.15172784G>C, NC_000019.10:g.15172784G>T, NC_000019.9:g.15283595G>C, NG_009819.1:g.33198C>A, NG_009819.1:g.33198C>G, NM_000435.2:c.4736+1284C>A, NM_000435.2:c.4736+1284C>G
    2.

    rs8100241 [Homo sapiens]
      AGTAGAGGAGCTGCTGCGCTGCGGC[A/G]CGGACCCTAATTTGGTGCTAGAGGA
      Chromosome:
      19:17282085
      Gene:
      ANKLE1 (GeneView)
      Functional Consequence:
      missense,nc transcript variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency
      Global MAF:
      A=0.4273/2140
      HGVS:
      CM000681.2:g.17282085G>A, NC_000019.10:g.17282085G>A, NC_000019.9:g.17392894G>A, NM_001278443.1:c.220G>A, NM_001278444.1:c.253G>A, NM_001278445.1:c.157G>A, NM_152363.5:c.253G>A, NP_001265372.1:p.Ala74Thr, NP_001265373.1:p.Ala85Thr, NP_001265374.1:p.Ala53Thr, NP_689576.5:p.Ala85Thr, NR_103530.1:n.367G>A
      3.

      rs2363956 [Homo sapiens]
        AGAGGTGACAACAGGGACATTGGCT[G/T]GGAGGCTGACCCAGGACCCCCCAGC
        Chromosome:
        19:17283315
        Gene:
        ANKLE1 (GeneView)
        Functional Consequence:
        missense,nc transcript variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4607/2307
        HGVS:
        CM000681.2:g.17283315T>G, NC_000019.10:g.17283315T>G, NC_000019.9:g.17394124T>G, NM_001278443.1:c.680T>G, NM_001278444.1:c.713T>G, NM_001278445.1:c.617T>G, NM_152363.5:c.713T>G, NP_001265372.1:p.Leu227Trp, NP_001265373.1:p.Leu238Trp, NP_001265374.1:p.Leu206Trp, NP_689576.5:p.Leu238Trp, NR_103530.1:n.827T>G
        4.

        rs1125436 [Homo sapiens]
          AAAAAATTCCAACCAGGCCAGGAAC[G/T]AACCTACCACGCCAAGGGTCAGCAA
          Chromosome:
          13:99721806
          Gene:
          CLYBL (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency
          Global MAF:
          C=0.2786/1395
          HGVS:
          CM000675.2:g.99721806A>C, NC_000013.10:g.100374060A>C, NC_000013.11:g.99721806A>C, NM_206808.3:c.63-51018A>C, NR_104592.1:n.95-51018A>C, XR_001749485.1:n.74-51018A>C, XR_931611.2:n.74-51018A>C

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center