Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs4236601 [Homo sapiens]
    TGACAGTCCTTTTCTAGTGTATTGT[A/G]TTTGTTAATATTTGTTAATATAATT
    Chromosome:
    7:116522675
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    A=0.2260/1132
    HGVS:
    NC_000007.13:g.116162729G>A, NC_000007.14:g.116522675G>A, NG_012051.1:g.2891G>A
    2.

    rs3807989 [Homo sapiens]
      TTGTTTGGTAACACTCAACATCAAC[A/G]TGTGCTACCAAATTGACACCAGAGG
      Chromosome:
      7:116546187
      Gene:
      CAV1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.4399/2203
      HGVS:
      NC_000007.13:g.116186241A>G, NC_000007.14:g.116546187A>G, NG_012051.1:g.26403A>G, NM_001172895.1:c.103-12759A>G, NM_001172896.1:c.103-12759A>G, NM_001172897.1:c.103-12759A>G, NM_001753.4:c.196-12759A>G
      3.

      rs1052990 [Homo sapiens]
        ACACATAGTTCTGTAATAAAACTGT[C/G/T]TGACTTCTCAAGTAACATGACTTCC
        Chromosome:
        7:116508316
        Gene:
        CAV2 (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        G=0.3125/1565
        HGVS:
        NC_000007.13:g.116148370T>G, NC_000007.14:g.116508316T>C, NC_000007.14:g.116508316T>G, NG_029920.1:g.13716T>C, NG_029920.1:g.13716T>G, NM_001206747.1:c.*2195T>C, NM_001206747.1:c.*2195T>G, NM_001206748.1:c.*2195T>C, NM_001206748.1:c.*2195T>G, NM_001233.4:c.*2195T>C, NM_001233.4:c.*2195T>G, NM_198212.2:c.*2157T>C, NM_198212.2:c.*2157T>G
        4.

        rs8940 [Homo sapiens]
          CTGCCTAATGGTTCTGCCTTCAGTG[C/G]AGACAATATGGAAGAGTGTGACAGA
          Chromosome:
          7:116506020
          Gene:
          CAV2 (GeneView)
          Functional Consequence:
          missense
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.1410/706
          HGVS:
          NC_000007.13:g.116146074C>G, NC_000007.14:g.116506020C>G, NG_029920.1:g.11420C>G, NM_001206747.1:c.349C>G, NM_001206748.1:c.139C>G, NM_001233.4:c.388C>G, NM_198212.2:c.200C>G, NP_001193676.1:p.Gln117Glu, NP_001193677.1:p.Gln47Glu, NP_001224.1:p.Gln130Glu, NP_937855.1:p.Ala67Gly

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center