Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

1.

rs13295103 [Homo sapiens]
    tagtttttttttttttgtttttttt[G/T]tttttttttttttttgagacggagt
    Chromosome:
    9:27481520
    Gene:
    MOB3B (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by cluster,by frequency
    HGVS:
    CM000671.2:g.27481520G>T, NC_000009.11:g.27481518G>T, NC_000009.12:g.27481520G>T, NM_024761.4:c.-198-25772C>A
    2.

    rs12608932 [Homo sapiens]
      ATCCATCCACCCATCAATTTATCCA[A/C]CCATCCATTTTTCGTCTGTCCACCA
      Chromosome:
      19:17641880
      Gene:
      UNC13A (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.4339/2173
      HGVS:
      CM000681.2:g.17641880A>C, NC_000019.10:g.17641880A>C, NC_000019.9:g.17752689A>C, NG_052872.1:g.51465T>G, NM_001080421.2:c.2473-324T>G
      3.

      rs10260404 [Homo sapiens]
        CAAGCTCCCAGTGGGGTCTGGGCCT[C/T]GTATGTCAACACAGCAAGATAGCTT
        Chromosome:
        7:154513713
        Gene:
        DPP6 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        C=0.3065/1535
        HGVS:
        CM000669.2:g.154513713T>C, NC_000007.13:g.154210798T>C, NC_000007.14:g.154513713T>C, NG_033878.1:g.631380T>C, NM_001039350.2:c.266-26819T>C, NM_001290252.1:c.272-26819T>C, NM_001290253.1:c.458-26819T>C, NM_001936.4:c.272-26819T>C, NM_130797.3:c.458-26819T>C, NW_012132919.1:g.91362T>C
        4.

        rs10122902 [Homo sapiens]
          TGACTTGCCGGAAAGGCAGCACAAA[A/G]CTTCCAGTTGAATCCTGTCAAAATA
          Chromosome:
          9:27556782
          Gene:
          C9orf72 (GeneView)
          Functional Consequence:
          synonymous codon
          Clinical significance:
          Benign
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2264/1134
          HGVS:
          CM000671.2:g.27556782G>A, NC_000009.11:g.27556780G>A, NC_000009.12:g.27556782G>A, NG_031977.1:g.22085C>T, NM_001256054.1:c.870C>T, NM_001256054.2:c.870C>T, NM_018325.4:c.870C>T, NP_001242983.1:p.Ser290, NP_060795.1:p.Ser290
          5.

          rs6700125 [Homo sapiens]
            GTTTCTGTCATAGCTGAGATTCCAT[A/C/T]GACTATGAGCAACTTGCAGACAGGG
            Chromosome:
            1:59237125
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.4637/2322
            HGVS:
            CM000663.2:g.59237125T>A, CM000663.2:g.59237125T>C, NC_000001.10:g.59702797T>C
            6.

            rs4879515 [Homo sapiens]
              GCTGAAGAGACCTAACATTAAAGGA[C/T]GGGAAAAACATTAAATAATCCAAAC
              Chromosome:
              9:27482237
              Gene:
              MOB3B (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency
              Global MAF:
              C=0.4465/2236
              HGVS:
              CM000671.2:g.27482237C>T, NC_000009.11:g.27482235C>T, NC_000009.12:g.27482237C>T, NM_024761.4:c.-198-26489G>A
              7.

              rs3849942 [Homo sapiens]
                GGTCTAGCTAGTACGTATTTCTTTT[A/G/T]TTGCATTTATTACACTATTCCTTTG
                Chromosome:
                9:27543283
                Gene:
                LOC107987057 (GeneView)
                Functional Consequence:
                nc transcript variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency
                Global MAF:
                T=0.1825/914
                HGVS:
                CM000671.2:g.27543283T>A, CM000671.2:g.27543283T>C, NC_000009.11:g.27543281T>C, NC_000009.12:g.27543283T>A, NC_000009.12:g.27543283T>C, XR_001746639.1:n.710A>G, XR_001746639.1:n.710A>T
                8.

                rs2814707 [Homo sapiens]
                  CTTGTAGCTAGGAATTCCAGGGTTG[A/C/G]CACTGGCTTTGGGCACTACTGGATG
                  Chromosome:
                  9:27536399
                  Gene:
                  LOC107987057 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency
                  Global MAF:
                  T=0.1725/864
                  HGVS:
                  CM000671.2:g.27536399C>G, CM000671.2:g.27536399C>T, NC_000009.11:g.27536397C>T, NC_000009.12:g.27536399C>G, NC_000009.12:g.27536399C>T, XR_001746639.1:n.7082-113G>A, XR_001746639.1:n.7082-113G>C
                  9.

                  rs2306677 [Homo sapiens]
                    TCAACTTACTGAAAAAAGTGAAATA[C/G/T]GTGTCATGACCACCACCCAGTTTTC
                    Chromosome:
                    12:26483453
                    Gene:
                    ITPR2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by submitter
                    Global MAF:
                    A=0.1891/947
                    HGVS:
                    CM000674.2:g.26483453A>C, CM000674.2:g.26483453A>G, NC_000012.11:g.26636386A>G, NC_000012.12:g.26483453A>C, NC_000012.12:g.26483453A>G, NG_042142.1:g.354746T>C, NG_042142.1:g.354746T>G, NM_002223.3:c.6012+245T>C, NM_002223.3:c.6012+245T>G, XR_001748686.1:n.6488+245T>C, XR_001748686.1:n.6488+245T>G
                    10.

                    rs2225389 [Homo sapiens]
                      AAGCAGCTTTGGGTTTAAACACCAG[A/C]AGGAAGTCAGCTCCACAAGGGAAGG
                      Chromosome:
                      9:27409266
                      Gene:
                      MOB3B (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by submitter
                      Global MAF:
                      G=0.0811/406
                      HGVS:
                      CM000671.2:g.27409266T>G, NC_000009.11:g.27409264T>G, NC_000009.12:g.27409266T>G, NM_024761.4:c.418+45867A>C
                      11.

                      rs903603 [Homo sapiens]
                        CCGGCTCCTCGTGTGCACTTCCCGG[C/T]AGGAACAAGGGTCGCCCACTTTCCA
                        Chromosome:
                        9:27529318
                        Gene:
                        MOB3B (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        A=0.4063/2035
                        HGVS:
                        CM000671.2:g.27529318G>A, NC_000009.11:g.27529316G>A, NC_000009.12:g.27529318G>A, NM_024761.4:c.-199+237C>T
                        12.

                        rs702231 [Homo sapiens]
                          TAAGGGCTGCAGAGTATTCATGAAC[A/C]GTAGTCATGAAACCAGTCCCTGTGT
                          Chromosome:
                          9:27588733
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency
                          Global MAF:
                          C=0.3383/1694
                          HGVS:
                          CM000671.2:g.27588733C>A, NC_000009.11:g.27588731C>A

                          Display Settings:

                          Format
                          Items per page
                          Sort by

                          Send to:

                          Choose Destination

                          Supplemental Content

                          Find related data

                          Recent activity

                          Your browsing activity is empty.

                          Activity recording is turned off.

                          Turn recording back on

                          See more...
                          Support Center