Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

1.

rs2228480 [Homo sapiens]
    GGGAGGCAGAGGGTTTCCCTGCCAC[A/G]GTCTGAGAGCTCCCTGGCTCCCACA
    Chromosome:
    6:152098960
    Gene:
    ESR1 (GeneView)
    Functional Consequence:
    intron variant,nc transcript variant,synonymous codon,utr variant 3 prime
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    A=0.1887/945
    HGVS:
    NC_000006.11:g.152420095G>A, NC_000006.12:g.152098960G>A, NG_008493.2:g.447270G>A, NM_000125.3:c.1782G>A, NM_001122740.1:c.1782G>A, NM_001122741.1:c.1782G>A, NM_001122742.1:c.1782G>A, NM_001291230.1:c.1788G>A, NM_001291241.1:c.1779G>A, NM_001328100.1:c.851-26306G>A, NP_000116.2:p.Thr594, NP_001116212.1:p.Thr594, NP_001116213.1:p.Thr594, NP_001116214.1:p.Thr594, NP_001278159.1:p.Thr596, NP_001278170.1:p.Thr593, XM_005266856.1:c.1788G>A, XM_005266857.1:c.1779G>A, XM_006715374.3:c.*197G>A, XM_006715375.3:c.1263G>A, XM_011535543.2:c.1782G>A, XM_011535544.2:c.1782G>A, XM_011535545.2:c.1782G>A, XM_011535549.2:c.1053G>A, XM_017010376.1:c.1782G>A, XM_017010377.1:c.1782G>A, XM_017010378.1:c.1782G>A, XM_017010379.1:c.1782G>A, XM_017010380.1:c.1782G>A, XM_017010381.1:c.1782G>A, XM_017010382.1:c.1125G>A, XM_017010383.1:c.993G>A, XP_005266913.1:p.Thr596, XP_005266914.1:p.Thr593, XP_006715438.1:p.Thr421, XP_011533845.1:p.Thr594, XP_011533846.1:p.Thr594, XP_011533847.1:p.Thr594, XP_011533851.1:p.Thr351, XP_016865865.1:p.Thr594, XP_016865866.1:p.Thr594, XP_016865867.1:p.Thr594, XP_016865868.1:p.Thr594, XP_016865869.1:p.Thr594, XP_016865870.1:p.Thr594, XP_016865871.1:p.Thr375, XP_016865872.1:p.Thr331, XR_001743222.1:n.2013G>A, XR_001743223.1:n.1829G>A
    2.

    rs2077647 [Homo sapiens]
      GGATCTGATGCAGTAGGGCCATCCC[A/G/T]GATGCTTTGGTGTGGAGGGTCATGG
      Chromosome:
      6:151807942
      Gene:
      ESR1 (GeneView)
      Functional Consequence:
      nc transcript variant,synonymous codon,upstream variant 2KB
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.4665/2336
      HGVS:
      NC_000006.11:g.152129077T>A, NC_000006.11:g.152129077T>C, NC_000006.12:g.151807942T>A, NC_000006.12:g.151807942T>C, NG_008493.2:g.156252T>A, NG_008493.2:g.156252T>C, NM_000125.3:c.30T>A, NM_000125.3:c.30T>C, NM_001122740.1:c.30T>A, NM_001122740.1:c.30T>C, NM_001122741.1:c.30T>A, NM_001122741.1:c.30T>C, NM_001122742.1:c.30T>A, NM_001122742.1:c.30T>C, NM_001291230.1:c.30T>A, NM_001291230.1:c.30T>C, NM_001291241.1:c.30T>A, NM_001291241.1:c.30T>C, NM_001328100.1:c.-1397T>A, NM_001328100.1:c.-1397T>C, NP_000116.2:p.Ser10, NP_001116212.1:p.Ser10, NP_001116213.1:p.Ser10, NP_001116214.1:p.Ser10, NP_001278159.1:p.Ser10, NP_001278170.1:p.Ser10, XM_005266856.1:c.30T>A, XM_005266856.1:c.30T>C, XM_005266857.1:c.30T>A, XM_005266857.1:c.30T>C, XM_006715374.3:c.30T>A, XM_006715374.3:c.30T>C, XM_006715375.3:c.-1397T>A, XM_006715375.3:c.-1397T>C, XM_011535543.2:c.30T>A, XM_011535543.2:c.30T>C, XM_011535544.2:c.30T>A, XM_011535544.2:c.30T>C, XM_011535545.2:c.30T>A, XM_011535545.2:c.30T>C, XM_011535547.2:c.30T>A, XM_011535547.2:c.30T>C, XM_017010376.1:c.30T>A, XM_017010376.1:c.30T>C, XM_017010377.1:c.30T>A, XM_017010377.1:c.30T>C, XM_017010378.1:c.30T>A, XM_017010378.1:c.30T>C, XM_017010379.1:c.30T>A, XM_017010379.1:c.30T>C, XM_017010380.1:c.30T>A, XM_017010380.1:c.30T>C, XM_017010381.1:c.30T>A, XM_017010381.1:c.30T>C, XM_017010382.1:c.-437T>A, XM_017010382.1:c.-437T>C, XP_005266913.1:p.Ser10, XP_005266914.1:p.Ser10, XP_006715437.1:p.Ser10, XP_011533845.1:p.Ser10, XP_011533846.1:p.Ser10, XP_011533847.1:p.Ser10, XP_011533849.1:p.Ser10, XP_016865865.1:p.Ser10, XP_016865866.1:p.Ser10, XP_016865867.1:p.Ser10, XP_016865868.1:p.Ser10, XP_016865869.1:p.Ser10, XP_016865870.1:p.Ser10, XR_001743222.1:n.400T>A, XR_001743222.1:n.400T>C, XR_001743223.1:n.400T>A, XR_001743223.1:n.400T>C
      4.

      rs767199 [Homo sapiens]
        CAACACAGGTGACATGAATGTGGAG[A/G]GTGGGGAATGGACTGCAGCACAGCC
        Chromosome:
        15:51248190
        Gene:
        CYP19A1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        A=0.2933/1469
        HGVS:
        NC_000015.10:g.51248190G>A, NC_000015.9:g.51540387G>A, NG_007982.1:g.95409C>T, NM_000103.3:c.-38-5240C>T, NM_001347248.1:c.-38-5240C>T, NM_001347249.1:c.-38-5240C>T, NM_001347250.1:c.-38-5240C>T, NM_001347251.1:c.-38-5240C>T, NM_001347252.1:c.-38-5240C>T, NM_001347253.1:c.-38-5240C>T, NM_031226.2:c.-38-5240C>T, XM_005254191.1:c.-38-5240C>T
        5.

        rs743572 [Homo sapiens]
          GGTGCCGGCAGGCAAGATAGACAGC[A/G/T]GTGGAGTAGAAGAGCTGTGGCAACT
          Chromosome:
          10:102837395
          Gene:
          CYP17A1 (GeneView)
          Functional Consequence:
          utr variant 5 prime
          Clinical significance:
          Benign
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          G=0.4105/2056
          HGVS:
          NC_000010.10:g.104597152A>G, NC_000010.11:g.102837395A>G, NC_000010.11:g.102837395A>T, NG_007955.1:g.5139T>A, NG_007955.1:g.5139T>C, NM_000102.3:c.-34T>A, NM_000102.3:c.-34T>C
          7.
          8.

          rs6201 [Homo sapiens]
            GAGAGCCTGCCAGGACGTCTCGGTC[A/G]TCATCCACACCGCCTGTATCATTGA
            Chromosome:
            1:119511592
            Gene:
            HSD3B1 (GeneView)
            Functional Consequence:
            missense
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            G=0.1366/684
            HGVS:
            NC_000001.10:g.120054215A>G, NC_000001.11:g.119511592A>G, NG_050909.1:g.9481A>G, NM_000862.2:c.235A>G, NM_001328615.1:c.235A>G, NP_000853.1:p.Ile79Val, NP_001315544.1:p.Ile79Val, XM_011541314.2:c.241A>G, XM_017001119.1:c.241A>G, XP_011539616.1:p.Ile81Val, XP_016856608.1:p.Ile81Val
            9.

            rs6162 [Homo sapiens]
              TGAAGAAGTTGTTATGCATATGGCC[A/G]TGTCTGGGGAGGAATGGCAGGCTGC
              Chromosome:
              10:102837224
              Gene:
              CYP17A1 (GeneView)
              Functional Consequence:
              synonymous codon
              Clinical significance:
              Benign
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.4425/2216
              HGVS:
              NC_000010.10:g.104596981G>A, NC_000010.11:g.102837224G>A, NG_007955.1:g.5310C>T, NM_000102.3:c.138C>T, NP_000093.1:p.His46

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center