Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 40

1.

rs17886199 [Homo sapiens]
    ACAGGAGTCTTTTAATTGGTTTAAG[C/T]ACTGTTAGAGGCTGAAGGGCCCTTA
    Chromosome:
    16:31093126
    Gene:
    VKORC1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0150/75
    HGVS:
    NC_000016.10:g.31093126A>G, NC_000016.9:g.31104447A>G, NG_011564.1:g.6830T>C, NM_001311311.1:c.283+186T>C, NM_024006.5:c.283+186T>C, NM_206824.2:c.173+1431T>C, XM_005255568.1:c.283+186T>C, XR_243303.1:n.832+186T>C
    2.

    rs17878544 [Homo sapiens]
      TAATTCCCTTTTGGCCATTTAACCT[A/G]TCATATTCACAAGTTCCAGGGATTC
      Chromosome:
      16:31096606
      Gene:
      VKORC1 (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.1208/605
      HGVS:
      NC_000016.10:g.31096606T>C, NC_000016.9:g.31107927T>C, NG_011564.1:g.3350A>G, NM_001311311.1:c.-1877A>G, NM_024006.5:c.-1877A>G, NM_206824.2:c.-1877A>G, XM_005255568.1:c.-1877A>G, XR_243303.1:n.-1228A>G
      3.

      rs17708472 [Homo sapiens]
        AAGTAATTCTTAAAATGGCAAGGCT[A/G]GTATAACGGTTCACTCGGTTTTGCA
        Chromosome:
        16:31094032
        Gene:
        VKORC1 (GeneView)
        Functional Consequence:
        intron variant
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.0937/469
        HGVS:
        NC_000016.10:g.31094032G>A, NC_000016.9:g.31105353G>A, NG_011564.1:g.5924C>T, NM_001311311.1:c.173+525C>T, NM_024006.5:c.173+525C>T, NM_206824.2:c.173+525C>T, XM_005255568.1:c.173+525C>T, XR_243303.1:n.822+525C>T
        4.

        rs17026452 [Homo sapiens]
          CGGTGTATTATCTTTAAAAAAAAAT[C/G]AAAACCCTCAACAGCAGAGTAACAC
          Chromosome:
          2:85556642
          Gene:
          GGCX (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.0877/439
          HGVS:
          NC_000002.11:g.85783765G>C, NC_000002.12:g.85556642G>C, NG_011811.2:g.9893C>G, NM_000821.6:c.540-382C>G, NM_001142269.3:c.369-382C>G, XM_005264259.1:c.540-382C>G, XM_005264259.4:c.540-382C>G, XM_011532764.2:c.-119-382C>G, XM_011532765.2:c.-119-382C>G, XM_017003803.1:c.369-382C>G, XR_001738703.1:n.605-382C>G
          5.

          rs17026447 [Homo sapiens]
            ATGGCAGGAAAAGATACCTAGAGCT[A/C]AACTGTCCTTTCCTGTATGACAGTC
            Chromosome:
            2:85550449
            Gene:
            GGCX (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.0479/240
            HGVS:
            NC_000002.11:g.85777572A>C, NC_000002.12:g.85550449A>C, NG_011811.2:g.16086T>G, NM_000821.6:c.2084+106T>G, NM_001142269.3:c.1913+106T>G, XM_005264259.1:c.2078+106T>G, XM_005264259.4:c.2078+106T>G, XM_011532764.2:c.1262+106T>G, XM_011532765.2:c.1262+106T>G, XM_017003803.1:c.1907+106T>G, XR_001738703.1:n.1997+106T>G
            6.

            rs11676382 [Homo sapiens]
              CTCTCCCCAGGGGAAAGTTACCAAG[C/G]TTGCCAACATATGATGGCAATGACA
              Chromosome:
              2:85550510
              Gene:
              GGCX (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.0256/128
              HGVS:
              NC_000002.11:g.85777633C>G, NC_000002.12:g.85550510C>G, NG_011811.2:g.16025G>C, NM_000821.6:c.2084+45G>C, NM_001142269.3:c.1913+45G>C, XM_005264259.1:c.2078+45G>C, XM_005264259.4:c.2078+45G>C, XM_011532764.2:c.1262+45G>C, XM_011532765.2:c.1262+45G>C, XM_017003803.1:c.1907+45G>C, XR_001738703.1:n.1997+45G>C
              7.

              rs10915884 [Homo sapiens]
                CCAAGAAGGGTCTAAAGAGACATGA[C/T]AGCTCAGTGGTGTGTGAGTCCTGGA
                Chromosome:
                1:225836174
                Gene:
                EPHX1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.1849/926
                HGVS:
                NC_000001.10:g.226023875C>T, NC_000001.11:g.225836174C>T, NG_009776.1:g.31079C>T, NM_000120.3:c.365-2480C>T, NM_001136018.3:c.365-2480C>T, NM_001291163.1:c.365-2480C>T, XM_005273085.1:c.365-2480C>T
                8.
                9.

                rs9934438 [Homo sapiens]
                  CCCCGACCTCCCATCCTAGTCCAAG[A/G]GTCGATGATCTCCTGGCACCGGGCA
                  Chromosome:
                  16:31093557
                  Gene:
                  VKORC1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Allele Origin:
                  G(germline)/A(germline)
                  Clinical significance:
                  drug-response
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.3558/1782
                  HGVS:
                  NC_000016.10:g.31093557G>A, NC_000016.9:g.31104878G>A, NG_011564.1:g.6399C>T, NM_001311311.1:c.174-136C>T, NM_024006.5:c.174-136C>T, NM_206824.2:c.173+1000C>T, XM_005255568.1:c.174-136C>T, XR_243303.1:n.823-236C>T
                  11.

                  rs8050894 [Homo sapiens]
                    CCACATCCCCACCCGCAGGACGCTC[C/G]GTGATGAGCAGCTAGCTGGCTGTCA
                    Chromosome:
                    16:31093188
                    Gene:
                    VKORC1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Clinical significance:
                    drug-response
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.4163/2085
                    HGVS:
                    NC_000016.10:g.31093188C>G, NC_000016.9:g.31104509C>G, NG_011564.1:g.6768G>C, NM_001311311.1:c.283+124G>C, NM_024006.5:c.283+124G>C, NM_206824.2:c.173+1369G>C, XM_005255568.1:c.283+124G>C, XR_243303.1:n.832+124G>C
                    12.

                    rs7568458 [Homo sapiens]
                      CTCCACCTCAAATCAAAGAAATCAC[A/T]GCACCAACAGCTCAGAGCTTCCGCC
                      Chromosome:
                      2:85561052
                      Gene:
                      GGCX (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.4868/2438
                      HGVS:
                      NC_000002.11:g.85788175T>A, NC_000002.12:g.85561052T>A, NG_011811.2:g.5483A>T, NM_000821.6:c.44-67A>T, NM_001142269.3:c.43+334A>T, NM_001311312.1:c.44-67A>T, XM_005264259.1:c.44-67A>T, XM_005264259.4:c.44-67A>T, XM_011532764.2:c.-615-67A>T, XM_011532765.2:c.-445+334A>T, XM_017003803.1:c.43+334A>T, XR_001738703.1:n.109-67A>T
                      13.

                      rs7200749 [Homo sapiens]
                        AGCACGAAGAACAGGATCCAGGCCA[A/G]GTAGACAGAACCAGCGAGAGACACC
                        Chromosome:
                        16:31091268
                        Gene:
                        PRSS53 (GeneView) VKORC1 (GeneView)
                        Functional Consequence:
                        missense,synonymous codon,upstream variant 2KB
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.0597/299
                        HGVS:
                        NC_000016.10:g.31091268G>A, NC_000016.9:g.31102589G>A, NG_011564.1:g.8688C>T, NM_001311311.1:c.442C>T, NM_024006.5:c.358C>T, NM_206824.2:c.248C>T, NP_001298240.1:p.Leu148, NP_076869.1:p.Leu120, NP_996560.1:p.Pro83Leu, XM_005255568.1:c.442C>T, XM_011545816.1:c.-2459C>T, XM_011545817.1:c.-2459C>T, XM_011545818.2:c.-2459C>T, XM_011545819.1:c.-2459C>T, XM_011545820.1:c.-2459C>T, XP_005255625.1:p.Leu148, XR_243303.1:n.907C>T
                        15.

                        rs6751560 [Homo sapiens]
                          TGATGGTGTAGACAAGATACATCCA[A/G]TCAAGTGGCAGTGGGCGTAGGGCAT
                          Chromosome:
                          2:85558951
                          Gene:
                          GGCX (GeneView)
                          Functional Consequence:
                          nc transcript variant,synonymous codon,utr variant 5 prime
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.0399/200
                          HGVS:
                          NC_000002.11:g.85786074G>A, NC_000002.12:g.85558951G>A, NG_011811.2:g.7584C>T, NM_000821.6:c.339C>T, NM_001142269.3:c.168C>T, NM_001311312.1:c.339C>T, NP_000812.2:p.Asp113, NP_001135741.1:p.Asp56, NP_001298241.1:p.Asp113, XM_005264259.1:c.339C>T, XM_005264259.4:c.339C>T, XM_011532764.2:c.-320C>T, XM_011532765.2:c.-320C>T, XM_017003803.1:c.168C>T, XP_005264316.1:p.Asp113, XP_016859292.1:p.Asp56, XR_001738703.1:n.404C>T
                          17.

                          rs3926327 [Homo sapiens]
                            TCAGTGAAAGAGAACCAGCAGCTCC[C/T]ATGAGTTTGGATAGCCTTATTTTCT
                            Chromosome:
                            4:73418969
                            Gene:
                            ALB (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.1068/535
                            HGVS:
                            NC_000004.11:g.74284686C>T, NC_000004.12:g.73418969C>T, NG_009291.1:g.19715C>T, NM_000477.6:c.1653-538C>T, XM_005265654.1:c.1077-538C>T
                            18.

                            rs3775486 [Homo sapiens]
                              CATGAAAAGATAAACAAGAACTGTG[G/T]CCCCTTGCTGTGCAATTTGACAAAC
                              Chromosome:
                              4:73409798
                              Gene:
                              ALB (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.4527/2267
                              HGVS:
                              NC_000004.11:g.74275515C>A, NC_000004.12:g.73409798C>A, NG_009291.1:g.10544C>A, NM_000477.6:c.615+311C>A, XM_005265654.1:c.138-2198C>A
                              19.

                              rs3766934 [Homo sapiens]
                                GTCAGAACTCGATGCTTTCTCCTCC[G/T]TCTGGGTCCTAACTGCAGTGCATCT
                                Chromosome:
                                1:225827316
                                Gene:
                                EPHX1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.1440/721
                                HGVS:
                                NC_000001.10:g.226015017G>T, NC_000001.11:g.225827316G>T, NG_009776.1:g.22221G>T, NM_000120.3:c.-5-1409G>T, NM_001136018.3:c.-5-1409G>T, NM_001291163.1:c.-5-1409G>T, XM_005273085.1:c.-5-1409G>T
                                20.

                                rs2884737 [Homo sapiens]
                                  GCAGCCATCGCCAACACCCCCCTTC[A/C]CCTGCGCGCCGTCCTTGAGACCATC
                                  Chromosome:
                                  16:31094233
                                  Gene:
                                  VKORC1 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Clinical significance:
                                  drug-response
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.0915/458
                                  HGVS:
                                  NC_000016.10:g.31094233A>C, NC_000016.9:g.31105554A>C, NG_011564.1:g.5723T>G, NM_001311311.1:c.173+324T>G, NM_024006.5:c.173+324T>G, NM_206824.2:c.173+324T>G, XM_005255568.1:c.173+324T>G, XR_243303.1:n.822+324T>G

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center