Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 64

1.

rs17782313 [Homo sapiens]
    GTTTAAAGCAGGAGAGATTGTATCC[C/T]GATGGAAATGACAAGAAAAGCTTCA
    Chromosome:
    18:60183864
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.2400/1202
    HGVS:
    NC_000018.10:g.60183864T>C, NC_000018.9:g.57851097T>C
    2.

    rs17700633 [Homo sapiens]
      GTTTCACTGTGTGGCAAGACAGAAT[A/G]TTGTGGTACCCGGTCGCTGCTAAGG
      Chromosome:
      18:60262199
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2434/1219
      HGVS:
      NC_000018.10:g.60262199G>A, NC_000018.9:g.57929432G>A
      3.

      rs16986921 [Homo sapiens]
        TACTCCACTTGTCTTTTTGAGGCTA[C/T]TGTTTAATAATCATCACATACTAGT
        Chromosome:
        20:37754119
        Gene:
        CTNNBL1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1036/519
        HGVS:
        NC_000020.10:g.36382521C>T, NC_000020.11:g.37754119C>T, NM_001281495.1:c.386-3440C>T, NM_030877.4:c.467-3440C>T, XM_011528917.2:c.137-3440C>T
        4.

        rs16986890 [Homo sapiens]
          ATTTTCTATTGTATCTGAGGGTTCA[A/G]TCTAAGAGTTTTAAAATGCAAATAT
          Chromosome:
          20:37698121
          Gene:
          CTNNBL1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.0775/388
          HGVS:
          NC_000020.10:g.36326523A>G, NC_000020.11:g.37698121A>G, NM_001281495.1:c.-153+3969A>G, NM_030877.4:c.30+3969A>G
          5.
          6.

          rs12970134 [Homo sapiens]
            CTGACTCTTACCAAACAAAGCATGA[A/G]CAAACAAAGATTTATCAGAAGGGTG
            Chromosome:
            18:60217517
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2075/1039
            HGVS:
            NC_000018.10:g.60217517G>A, NC_000018.9:g.57884750G>A
            7.

            rs12779790 [Homo sapiens]
              cccggACAatgttgggaattttttc[A/G]tatttcttggccatttatatatctt
              Chromosome:
              10:12286011
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1579/791
              HGVS:
              NC_000010.10:g.12328010A>G, NC_000010.11:g.12286011A>G
              8.

              rs11084753 [Homo sapiens]
                ACATGCTACAACATGGGCAAACTTC[A/G]AAAACATTGTGTGGCCAAGTGCGGT
                Chromosome:
                19:33831232
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.4253/2130
                HGVS:
                NC_000019.10:g.33831232A>G, NC_000019.9:g.34322137A>G
                9.

                rs10938397 [Homo sapiens]
                  TGTTTTTACTTTACTTCTCATGGGA[A/G]GTTTTCAAGAATGTTCTTAGCATTA
                  Chromosome:
                  4:45180510
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.3261/1633
                  HGVS:
                  NC_000004.11:g.45182527A>G, NC_000004.12:g.45180510A>G
                  10.

                  rs10923931 [Homo sapiens]
                    CTTGTTGCTCCATCCTCTGGCTTCA[G/T]GCTGAACAAGTAAGATTATGGGCAC
                    Chromosome:
                    1:119975336
                    Gene:
                    NOTCH2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.1921/962
                    HGVS:
                    NC_000001.10:g.120517959G>T, NC_000001.11:g.119975336G>T, NG_008163.1:g.99318C>A, NM_001200001.1:c.875-5592C>A, NM_024408.3:c.875-5592C>A, NW_003871056.3:g.46910G>T, XM_005270901.1:c.758-5592C>A, XM_005270901.3:c.758-5592C>A, XM_005270902.1:c.758-5592C>A, XM_011541519.2:c.863-5592C>A, XM_011541520.2:c.758-5592C>A, XM_017001372.1:c.827-5592C>A, XM_017001373.1:c.758-5592C>A
                    11.

                    rs10913469 [Homo sapiens]
                      AAGGTTTTGCCTTCATATTATAAAA[C/T]ACAGACCTTTAGGGGACATAAAAAG
                      Chromosome:
                      1:177944384
                      Gene:
                      SEC16B (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.2318/1161
                      HGVS:
                      NC_000001.10:g.177913519T>C, NC_000001.11:g.177944384T>C, NM_033127.2:c.1881+177A>G, XM_005245573.1:c.1884+177A>G, XM_005245574.1:c.1884+177A>G, XM_005245575.1:c.546+177A>G
                      12.
                      13.

                      rs10830963 [Homo sapiens]
                        GTGATGCTAAGAATTCACACCATCT[C/G]CTATCCAGAACCAGTAACTGCCTGG
                        Chromosome:
                        11:92975544
                        Gene:
                        MTNR1B (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.2602/1303
                        HGVS:
                        NC_000011.10:g.92975544C>G, NC_000011.9:g.92708710C>G, NG_028160.1:g.10922C>G, NM_005959.3:c.223+5596C>G, XM_011542839.2:c.223+5596C>G, XM_017017777.1:c.-2147C>G
                        14.

                        rs10811661 [Homo sapiens]
                          CAGCTCACCTCCAGCTTTAGTTTTC[C/T]CATGACAGTAAGTCTATTACCCTCC
                          Chromosome:
                          9:22134095
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.1763/883
                          HGVS:
                          NC_000009.11:g.22134094T>C, NC_000009.12:g.22134095T>C
                          15.

                          rs10508503 [Homo sapiens]
                            CGAGTTCAAGATACGTTATAGGAGA[C/T]CGTGATGCATAATAGACGCTTTAAG
                            Chromosome:
                            10:16257952
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.0306/153
                            HGVS:
                            NC_000010.10:g.16299951C>T, NC_000010.11:g.16257952C>T
                            16.

                            rs10487818 [Homo sapiens]
                              CATGAAACTTTCTAAAAATTGATCC[A/T]TTTATCACATAGTCTTTCAAAATAT
                              Chromosome:
                              7:106269615
                              Gene:
                              NAMPT (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              T=0.0102/51
                              HGVS:
                              NC_000007.13:g.105910061A>T, NC_000007.14:g.106269615A>T, NM_005746.2:c.448-303T>A, XM_005250100.1:c.448-303T>A, XM_005250100.2:c.448-303T>A, XM_005250101.1:c.448-303T>A
                              17.

                              rs10010131 [Homo sapiens]
                                CACACAAGGCCTTTGACCACATCCT[A/G]TCCCTCAGGCATCACGTCCGAGAAC
                                Chromosome:
                                4:6291188
                                Gene:
                                WFS1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Allele Origin:
                                G(germline)/A(germline)
                                Clinical significance:
                                other
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.2712/1358
                                HGVS:
                                NC_000004.11:g.6292915A>G, NC_000004.12:g.6291188A>G, NG_011700.1:g.26339A>G, NM_001145853.1:c.461-9A>G, NM_006005.2:c.461-9A>G, NM_006005.3:c.461-9A>G, XM_017008586.1:c.470-9A>G
                                18.
                                19.
                                20.

                                rs7961581 [Homo sapiens]
                                  CTGGATGCCAAAGCTCAGGAGTAAA[C/T]GAGGATGAAAAGTAGTTATCAACTC
                                  Chromosome:
                                  12:71269322
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.2384/1194
                                  HGVS:
                                  NC_000012.11:g.71663102C>T, NC_000012.12:g.71269322C>T

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center