Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 17

1.

rs11136000 [Homo sapiens]
    ACCAAAGCCACACCAGCTATCAAAA[C/T]TCTCTAACGGGCCCTTGCCACTTGA
    Chromosome:
    8:27607002
    Gene:
    CLU (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.3782/1894
    HGVS:
    NC_000008.10:g.27464519T>C, NC_000008.11:g.27607002T>C, NG_027845.1:g.12809A>G, NM_001831.3:c.247-478A>G, NR_038335.1:n.568-478A>G, NR_045494.1:n.427-478A>G, XM_006716284.2:c.403-478A>G
    2.

    rs9331888 [Homo sapiens]
      GAGCAAGAGGACTCATCCTTCCAAA[C/G]GGACTTTCTCTGGGAAGCCTGCTCC
      Chromosome:
      8:27611345
      Gene:
      CLU (GeneView) MIR6843 (GeneView)
      Functional Consequence:
      intron variant,nc transcript variant,upstream variant 2KB
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3335/1670
      HGVS:
      NC_000008.10:g.27468862C>G, NC_000008.11:g.27611345C>G, NG_027845.1:g.8466G>C, NM_001831.3:c.-29-745G>C, NR_038335.1:n.93G>C, NR_045494.1:n.151+256G>C, NR_106902.1:n.-594G>C, XM_006716284.2:c.128-745G>C
      3.

      rs7941541 [Homo sapiens]
        TGAGCTTTACAAACTTCCAATTCCT[A/G]ACTAGGGAAAGTTGGGATCTTTTTA
        Chromosome:
        11:86147496
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2891/1448
        HGVS:
        NC_000011.10:g.86147496G>A, NC_000011.9:g.85858538G>A
        4.

        rs7012010 [Homo sapiens]
          ATGAAGCCAGCCCAGCTGGGAGGTA[C/T]gtaacagttagttttctgtgtcaac
          Chromosome:
          8:27591212
          Gene:
          EPHX2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.3259/1632
          HGVS:
          NC_000008.10:g.27448729T>C, NC_000008.11:g.27591212T>C, XR_001745491.1:n.1648-1121T>C
          5.

          rs6701713 [Homo sapiens]
            gataatgcctgcagcccaacagatg[A/G]cagtgtgcttaacagctctgtcaat
            Chromosome:
            1:207612944
            Gene:
            CR1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2484/1244
            HGVS:
            NC_000001.10:g.207786289A>G, NC_000001.11:g.207612944A>G, NG_007481.1:g.121817A>G, NM_000573.3:c.5225+903A>G, NM_000651.4:c.6575+903A>G, XM_005273064.1:c.6191+903A>G, XM_006711166.2:c.6590+903A>G, XM_011509205.1:c.6590+903A>G
            6.

            rs3851179 [Homo sapiens]
              GCAAACAATACACACTTCAGTAAAT[A/G]TTATCTATCACAACTATTATATGGT
              Chromosome:
              11:86157598
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3149/1577
              HGVS:
              NC_000011.10:g.86157598T>C, NC_000011.9:g.85868640T>C
              7.

              rs3818361 [Homo sapiens]
                GTTAGATATGGGGCAATTTCCTTTG[C/T]TATATCTTATGCTTACCAGAGGGCT
                Chromosome:
                1:207611623
                Gene:
                CR1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.2486/1245
                HGVS:
                NC_000001.10:g.207784968A>G, NC_000001.11:g.207611623A>G, NG_007481.1:g.120496A>G, NM_000573.3:c.4946-54A>G, NM_000651.4:c.6296-54A>G, XM_005273064.1:c.5912-54A>G, XM_006711166.2:c.6311-54A>G, XM_011509205.1:c.6311-54A>G
                8.

                rs3087554 [Homo sapiens]
                  ATGCCTTCATTTTGCTATGGGGGGC[A/G]GGCAGGGGGGATGGAAAATAAGTAG
                  Chromosome:
                  8:27597925
                  Gene:
                  CLU (GeneView) EPHX2 (GeneView)
                  Functional Consequence:
                  downstream variant 500B,nc transcript variant,utr variant 3 prime
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.2420/1212
                  HGVS:
                  NC_000008.10:g.27455442T>C, NC_000008.11:g.27597925T>C, NG_027845.1:g.21886A>G, NM_001831.3:c.*316A>G, NR_038335.1:n.1987A>G, NR_045494.1:n.1846A>G, XM_006716284.2:c.*316A>G, XR_001745491.1:n.2786T>C
                  9.

                  rs1408077 [Homo sapiens]
                    CTTATAGAGTCATCACCCCAAAACA[G/T]TGGAAATGACAATAATAATCCAATA
                    Chromosome:
                    1:207630796
                    Gene:
                    CR1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    A=0.1412/707
                    HGVS:
                    NC_000001.10:g.207804141A>C, NC_000001.11:g.207630796A>C, NG_007481.1:g.139669A>C, NM_000573.3:c.6107+175A>C, NM_000651.4:c.7457+175A>C, XM_005273064.1:c.7073+175A>C, XM_006711166.2:c.7367+7728A>C, XM_011509205.1:c.7472+175A>C
                    10.

                    rs677909 [Homo sapiens]
                      AGTGTATTGGAAAGGTGATAGAGGA[A/G]TTGTCTCCTAAAATGAGGGAAAACA
                      Chromosome:
                      11:86046547
                      Gene:
                      PICALM (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.3041/1523
                      HGVS:
                      NC_000011.10:g.86046547C>T, NC_000011.9:g.85757589C>T, NG_028942.1:g.28335G>A, NM_001008660.2:c.131-14936G>A, NM_001206946.1:c.131-14936G>A, NM_001206947.1:c.-23-14936G>A, NM_007166.3:c.131-14936G>A, XM_005274322.1:c.131-14936G>A, XM_005274322.2:c.131-14936G>A, XM_005274323.1:c.131-14936G>A, XM_005274323.2:c.131-14936G>A, XM_005274324.1:c.131-14936G>A, XM_005274324.2:c.131-14936G>A, XM_005274325.1:c.131-14936G>A, XM_005274325.2:c.131-14936G>A, XM_005274326.1:c.131-14936G>A, XM_005274326.2:c.131-14936G>A, XM_005274327.1:c.131-14936G>A, XM_005274327.2:c.131-14936G>A, XM_005274328.1:c.131-14936G>A, XM_005274328.2:c.131-14936G>A, XM_005274329.1:c.131-14936G>A, XM_005274329.3:c.131-14936G>A, XM_005274330.1:c.131-14936G>A, XM_005274330.2:c.131-14936G>A, XM_005274331.1:c.131-14936G>A, XM_005274331.2:c.131-14936G>A, XM_005274332.1:c.131-14936G>A, XM_005274332.2:c.131-14936G>A, XM_005274333.1:c.131-14936G>A, XM_005274333.2:c.131-14936G>A, XM_005274334.1:c.131-14936G>A, XM_005274334.2:c.131-14936G>A, XM_005274335.1:c.131-14936G>A, XM_005274335.2:c.131-14936G>A, XM_005274336.1:c.131-14936G>A, XM_005274336.2:c.131-14936G>A, XM_005274337.1:c.131-14936G>A, XM_005274337.2:c.131-14936G>A, XM_005274340.1:c.131-14936G>A, XM_005274340.2:c.131-14936G>A, XM_006718699.2:c.131-14936G>A, XM_006718700.2:c.131-14936G>A, XM_006718701.3:c.131-14936G>A, XM_011545293.1:c.131-14936G>A, XM_017018381.1:c.131-14936G>A, XM_017018382.1:c.131-14936G>A, XM_017018383.1:c.131-14936G>A, XM_017018384.1:c.131-14936G>A, XM_017018385.1:c.131-14936G>A, XM_017018386.1:c.131-14936G>A, XM_017018387.1:c.131-14936G>A, XM_017018388.1:c.131-14936G>A
                      11.

                      rs636848 [Homo sapiens]
                        AGTAACTCCCCCATCGCTACCCTAA[A/G]GGATGAAATTAAGAACTCTCAACCT
                        Chromosome:
                        11:86071625
                        Gene:
                        PICALM (GeneView)
                        Functional Consequence:
                        upstream variant 2KB
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        G=0.2554/1279
                        HGVS:
                        NC_000011.10:g.86071625A>G, NC_000011.9:g.85782667A>G, NG_028942.1:g.3257T>C, NM_001206947.1:c.-1929T>C
                        12.

                        rs592297 [Homo sapiens]
                          CATTAAAATCAAGAAGTGCATCCAT[C/T]TGATTCTGAATAATTGGTACAGTTT
                          Chromosome:
                          11:86014894
                          Gene:
                          PICALM (GeneView)
                          Functional Consequence:
                          synonymous codon
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          C=0.2113/1058
                          HGVS:
                          NC_000011.10:g.86014894C>T, NC_000011.9:g.85725937C>T, NG_028942.1:g.59987G>A, NM_001008660.2:c.522G>A, NM_001206946.1:c.522G>A, NM_001206947.1:c.369G>A, NM_007166.3:c.522G>A, NP_001008660.1:p.Gln174, NP_001193875.1:p.Gln174, NP_001193876.1:p.Gln123, NP_009097.2:p.Gln174, XM_005274322.1:c.522G>A, XM_005274322.2:c.522G>A, XM_005274323.1:c.522G>A, XM_005274323.2:c.522G>A, XM_005274324.1:c.522G>A, XM_005274324.2:c.522G>A, XM_005274325.1:c.522G>A, XM_005274325.2:c.522G>A, XM_005274326.1:c.522G>A, XM_005274326.2:c.522G>A, XM_005274327.1:c.522G>A, XM_005274327.2:c.522G>A, XM_005274328.1:c.522G>A, XM_005274328.2:c.522G>A, XM_005274329.1:c.522G>A, XM_005274329.3:c.522G>A, XM_005274330.1:c.522G>A, XM_005274330.2:c.522G>A, XM_005274331.1:c.522G>A, XM_005274331.2:c.522G>A, XM_005274332.1:c.522G>A, XM_005274332.2:c.522G>A, XM_005274333.1:c.522G>A, XM_005274333.2:c.522G>A, XM_005274334.1:c.522G>A, XM_005274334.2:c.522G>A, XM_005274335.1:c.522G>A, XM_005274335.2:c.522G>A, XM_005274336.1:c.522G>A, XM_005274336.2:c.522G>A, XM_005274337.1:c.522G>A, XM_005274337.2:c.522G>A, XM_005274338.1:c.165G>A, XM_005274339.1:c.369G>A, XM_005274340.1:c.522G>A, XM_005274340.2:c.522G>A, XM_006718699.2:c.522G>A, XM_006718700.2:c.522G>A, XM_006718701.3:c.522G>A, XM_011545293.1:c.522G>A, XM_017018381.1:c.522G>A, XM_017018382.1:c.522G>A, XM_017018383.1:c.522G>A, XM_017018384.1:c.522G>A, XM_017018385.1:c.522G>A, XM_017018386.1:c.522G>A, XM_017018387.1:c.522G>A, XM_017018388.1:c.522G>A, XP_005274379.1:p.Gln174, XP_005274380.1:p.Gln174, XP_005274381.1:p.Gln174, XP_005274382.1:p.Gln174, XP_005274383.1:p.Gln174, XP_005274384.1:p.Gln174, XP_005274385.1:p.Gln174, XP_005274386.1:p.Gln174, XP_005274387.1:p.Gln174, XP_005274388.1:p.Gln174, XP_005274389.1:p.Gln174, XP_005274390.1:p.Gln174, XP_005274391.1:p.Gln174, XP_005274392.1:p.Gln174, XP_005274393.1:p.Gln174, XP_005274394.1:p.Gln174, XP_005274395.1:p.Gln55, XP_005274396.1:p.Gln123, XP_005274397.1:p.Gln174, XP_006718762.1:p.Gln174, XP_006718763.1:p.Gln174, XP_006718764.1:p.Gln174, XP_011543595.1:p.Gln174, XP_016873870.1:p.Gln174, XP_016873871.1:p.Gln174, XP_016873872.1:p.Gln174, XP_016873873.1:p.Gln174, XP_016873874.1:p.Gln174, XP_016873875.1:p.Gln174, XP_016873876.1:p.Gln174, XP_016873877.1:p.Gln174
                          13.

                          rs561655 [Homo sapiens]
                            ACTAAAGACAGTCCTGGGTAATTCC[A/G]ACATTAAAGGGGCAGCATACAATTT
                            Chromosome:
                            11:86089237
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            G=0.3407/1706
                            HGVS:
                            NC_000011.10:g.86089237G>A, NC_000011.9:g.85800279G>A
                            14.

                            rs543293 [Homo sapiens]
                              GCCAAAAGTCAAGAGAAATTGAAAG[A/G]CTTTGGGCAGTGGTTAAGCAGCTAC
                              Chromosome:
                              11:86109035
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.2923/1464
                              HGVS:
                              NC_000011.10:g.86109035A>G, NC_000011.9:g.85820077A>G
                              15.

                              rs541458 [Homo sapiens]
                                AACCAATCCCTGCACTGGCTACTAA[C/T]GTGCACCATAAATTCCCCCCTATGA
                                Chromosome:
                                11:86077309
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                C=0.3520/1763
                                HGVS:
                                NC_000011.10:g.86077309C>T, NC_000011.9:g.85788351C>T
                                16.

                                rs532470 [Homo sapiens]
                                  GTTTACATTTTGCAACTCATTGAAT[A/C]GAAAAAGTTAGGCTTTGTTACTACA
                                  Chromosome:
                                  11:85975053
                                  Gene:
                                  PICALM (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  G=0.4952/2480
                                  HGVS:
                                  NC_000011.10:g.85975053T>G, NC_000011.9:g.85686096T>G, NG_028942.1:g.99828A>C, NM_001008660.2:c.1714-241A>C, NM_001206946.1:c.1819-241A>C, NM_001206947.1:c.1537-241A>C, NM_007166.3:c.1840-241A>C, XM_005274322.1:c.1864-241A>C, XM_005274322.2:c.1864-241A>C, XM_005274323.1:c.1849-241A>C, XM_005274323.2:c.1849-241A>C, XM_005274324.1:c.1840-241A>C, XM_005274324.2:c.1840-241A>C, XM_005274325.1:c.1825-241A>C, XM_005274325.2:c.1825-241A>C, XM_005274326.1:c.1864-241A>C, XM_005274326.2:c.1864-241A>C, XM_005274327.1:c.1780-241A>C, XM_005274327.2:c.1780-241A>C, XM_005274328.1:c.1849-241A>C, XM_005274328.2:c.1849-241A>C, XM_005274329.1:c.1825-241A>C, XM_005274329.3:c.1825-241A>C, XM_005274330.1:c.1714-241A>C, XM_005274330.2:c.1714-241A>C, XM_005274331.1:c.1780-241A>C, XM_005274331.2:c.1780-241A>C, XM_005274332.1:c.1699-241A>C, XM_005274332.2:c.1699-241A>C, XM_005274333.1:c.1690-241A>C, XM_005274333.2:c.1690-241A>C, XM_005274334.1:c.1765-241A>C, XM_005274334.2:c.1765-241A>C, XM_005274335.1:c.1675-241A>C, XM_005274335.2:c.1675-241A>C, XM_005274336.1:c.1699-241A>C, XM_005274336.2:c.1699-241A>C, XM_005274337.1:c.1779+6076A>C, XM_005274337.2:c.1779+6076A>C, XM_005274338.1:c.1507-241A>C, XM_005274339.1:c.1537-241A>C, XM_005274340.1:c.1629+6076A>C, XM_005274340.2:c.1629+6076A>C, XM_006718699.2:c.1843-241A>C, XM_006718700.2:c.1828-241A>C, XM_006718701.3:c.1819-241A>C, XM_011545293.1:c.1606-241A>C, XM_017018381.1:c.1828-241A>C, XM_017018382.1:c.1630-241A>C, XM_017018383.1:c.1690-241A>C, XM_017018384.1:c.1675-241A>C, XM_017018385.1:c.1764+6076A>C, XM_017018386.1:c.1630-241A>C, XM_017018387.1:c.1615-241A>C, XM_017018388.1:c.1606-241A>C
                                  17.

                                  rs7982 [Homo sapiens]
                                    AGCAGGCCATGGACATCCACTTCCA[C/T]AGCCCGGCCTTCCAGCACCCGCCAA
                                    Chromosome:
                                    8:27604964
                                    Gene:
                                    CLU (GeneView)
                                    Functional Consequence:
                                    nc transcript variant,synonymous codon
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    A=0.3355/1680
                                    HGVS:
                                    NC_000008.10:g.27462481A>G, NC_000008.11:g.27604964A>G, NG_027845.1:g.14847T>C, NM_001831.3:c.789T>C, NP_001822.3:p.His263, NR_038335.1:n.1110T>C, NR_045494.1:n.969T>C, XM_006716284.2:c.945T>C, XP_006716347.1:p.His315

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center