Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 15

1.

rs77275268 [Homo sapiens]
    GGTGTGAACTGTCTGTGTGTCTCTC[C/T]GCCATGGACACCTGCACCTGTTATG
    Chromosome:
    6:151648063
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.1040/521
    HGVS:
    NC_000006.11:g.151969198C>T, NC_000006.12:g.151648063C>T
    2.

    rs12665607 [Homo sapiens]
      CAGTTTTCCTATAGGACTGTGAATG[A/T]CTTCCCAAGGCATTTAGGAAGCTAT
      Chromosome:
      6:151625494
      Allele Origin:
      T(germline)/A(germline,somatic)
      Clinical significance:
      Uncertain significance
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1036/519
      HGVS:
      NC_000006.11:g.151946629T>A, NC_000006.12:g.151625494T>A
      3.

      rs12662670 [Homo sapiens]
        GGCAGAGCAAAAAGAAATGGAAACT[C/G/T]ACAAGAATTTAATCAAAAGATTTAC
        Chromosome:
        6:151597721
        Gene:
        CCDC170 (GeneView)
        Functional Consequence:
        intron variant
        Allele Origin:
        G(somatic)/T(germline,somatic)
        Clinical significance:
        Uncertain significance
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1066/534
        HGVS:
        NC_000006.11:g.151918856T>C, NC_000006.11:g.151918856T>G, NC_000006.12:g.151597721T>C, NC_000006.12:g.151597721T>G, NG_021198.1:g.108682T>C, NG_021198.1:g.108682T>G, NM_025059.3:c.1710+1144T>C, NM_025059.3:c.1710+1144T>G, XM_011536147.2:c.1728+1144T>C, XM_011536147.2:c.1728+1144T>G, XM_011536148.2:c.1527+1144T>C, XM_011536148.2:c.1527+1144T>G
        4.

        rs9397435 [Homo sapiens]
          TTGGGGATCAGGCTGATTGGCTTCA[A/G]TTGAATGTTAAAGCTGAATTTTTAA
          Chromosome:
          6:151630085
          Allele Origin:
          G(somatic)/A(germline,somatic)
          Clinical significance:
          Uncertain significance
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.1152/577
          HGVS:
          NC_000006.11:g.151951220A>G, NC_000006.12:g.151630085A>G
          5.

          rs9383932 [Homo sapiens]
            GGTGAGAGACCGTCACAAATTTCAC[A/G]AGTCAAATAATAGATATAGGAGAGA
            Chromosome:
            6:151598585
            Gene:
            CCDC170 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.1883/943
            HGVS:
            NC_000006.11:g.151919720A>G, NC_000006.12:g.151598585A>G, NG_021198.1:g.109546A>G, NM_025059.3:c.1710+2008A>G, XM_011536147.2:c.1728+2008A>G, XM_011536148.2:c.1527+2008A>G
            6.

            rs9383589 [Homo sapiens]
              CCTAATTCATTTGGATCAAACTTAC[A/G]TAGGTCTCAGGTCCTGTAAGAAACT
              Chromosome:
              6:151619125
              Gene:
              CCDC170 (GeneView)
              Functional Consequence:
              utr variant 3 prime
              Allele Origin:
              G(somatic)/A(germline,somatic)
              Clinical significance:
              Uncertain significance
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.1022/512
              HGVS:
              NC_000006.11:g.151940260A>G, NC_000006.12:g.151619125A>G, NG_021198.1:g.130086A>G, NM_025059.3:c.*978A>G, XM_011536147.2:c.*978A>G, XM_011536148.2:c.*978A>G
              7.

              rs7752591 [Homo sapiens]
                TTGCAGGTTTAGCTCCTGAGTGTGC[A/G]ATTCGACTAAACTTCTGCATCCAAA
                Chromosome:
                6:151625933
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.4698/2353
                HGVS:
                NC_000006.11:g.151947068G>A, NC_000006.12:g.151625933G>A
                8.

                rs6932260 [Homo sapiens]
                  ATTGGGAAATGGGAGTGGGAGATAA[C/T]ATTGGGAGGTATCTATTTTAAGTCA
                  Chromosome:
                  6:151618425
                  Gene:
                  CCDC170 (GeneView) LOC107986528 (GeneView)
                  Functional Consequence:
                  upstream variant 2KB,utr variant 3 prime
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.4675/2341
                  HGVS:
                  NC_000006.11:g.151939560T>C, NC_000006.12:g.151618425T>C, NG_021198.1:g.129386T>C, NM_025059.3:c.*278T>C, XM_011536147.2:c.*278T>C, XM_011536148.2:c.*278T>C, XR_001743865.1:n.-1576A>G
                  9.

                  rs6929137 [Homo sapiens]
                    GAAAGCTGAGAAAAAGCTCATGTCT[A/G]TCAAGTCAGAACTGGATACCACAGA
                    Chromosome:
                    6:151615542
                    Gene:
                    CCDC170 (GeneView) LOC107986528 (GeneView)
                    Functional Consequence:
                    intron variant,missense
                    Allele Origin:
                    G(germline)/A(germline,somatic)
                    Clinical significance:
                    Likely pathogenic
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.3494/1750
                    HGVS:
                    NC_000006.11:g.151936677G>A, NC_000006.12:g.151615542G>A, NG_021198.1:g.126503G>A, NM_025059.3:c.1810G>A, NP_079335.2:p.Val604Ile, XM_011536147.2:c.1828G>A, XM_011536148.2:c.1627G>A, XP_011534449.1:p.Val610Ile, XP_011534450.1:p.Val543Ile, XR_001743865.1:n.129+1179C>T
                    10.

                    rs6900157 [Homo sapiens]
                      TGTTTGAGGAAGAATTATTAAATTA[C/T]TGATGCTTTAACAAATCTGTTTTTT
                      Chromosome:
                      6:151632992
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.4185/2096
                      HGVS:
                      NC_000006.11:g.151954127T>C, NC_000006.12:g.151632992T>C
                      11.

                      rs3734805 [Homo sapiens]
                        CAATTCCCAATTTCACAAATTCCTC[A/C]TGTCTTTGAGATTTGATCAGTTTGT
                        Chromosome:
                        6:151618215
                        Gene:
                        CCDC170 (GeneView) LOC107986528 (GeneView)
                        Functional Consequence:
                        upstream variant 2KB,utr variant 3 prime
                        Allele Origin:
                        A(germline)/C(germline,somatic)
                        Clinical significance:
                        Uncertain significance
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.1050/526
                        HGVS:
                        NC_000006.11:g.151939350A>C, NC_000006.12:g.151618215A>C, NG_021198.1:g.129176A>C, NM_025059.3:c.*68A>C, XM_011536147.2:c.*68A>C, XM_011536148.2:c.*68A>C, XR_001743865.1:n.-1366T>G
                        12.

                        rs3734804 [Homo sapiens]
                          AATCATCAAGTGTCTTGAAAGATTG[A/G]TCCATTCACATCAGCATCACTTTGT
                          Chromosome:
                          6:151618046
                          Gene:
                          CCDC170 (GeneView) LOC107986528 (GeneView)
                          Functional Consequence:
                          missense,upstream variant 2KB
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.4685/2346
                          HGVS:
                          NC_000006.11:g.151939181G>A, NC_000006.12:g.151618046G>A, NG_021198.1:g.129007G>A, NM_025059.3:c.2047G>A, NP_079335.2:p.Val683Ile, XM_011536147.2:c.2065G>A, XM_011536148.2:c.1864G>A, XP_011534449.1:p.Val689Ile, XP_011534450.1:p.Val622Ile, XR_001743865.1:n.-1197C>T
                          13.

                          rs2165241 [Homo sapiens]
                            AACTGAGCTCTCAAATGCCACAATA[C/T]TGGCAGAGGCATGCCTGGGACTTGG
                            Chromosome:
                            15:73929861
                            Gene:
                            LOXL1-AS1 (GeneView) LOXL1 (GeneView)
                            Functional Consequence:
                            intron variant,upstream variant 2KB
                            Clinical significance:
                            other
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.2871/1438
                            HGVS:
                            NC_000015.10:g.73929861T>C, NC_000015.9:g.74222202T>C, NG_011466.1:g.8414T>C, NM_005576.3:c.1102+1976T>C, NR_040068.1:n.-1613A>G, NR_040069.1:n.-1613A>G, NR_040070.1:n.-1901A>G, XM_005254380.1:c.1102+1976T>C, XM_011521555.1:c.1102+1976T>C, XR_931824.1:n.1435+1976T>C
                            14.

                            rs2046210 [Homo sapiens]
                              GTGAATCTTTTATTTCAGGTAGATG[C/T]GTATGTGACTGTATGTATGTGTGAG
                              Chromosome:
                              6:151627231
                              Allele Origin:
                              T(somatic)/C(germline,somatic)
                              Clinical significance:
                              Likely pathogenic
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.4121/2064
                              HGVS:
                              NC_000006.11:g.151948366G>A, NC_000006.12:g.151627231G>A
                              15.

                              rs852003 [Homo sapiens]
                                ataacatcACTAATCACAAACTTAT[A/G]TAAACCATTACTGGAGATGTTCTAC
                                Chromosome:
                                6:151641067
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                C=0.4333/2170
                                HGVS:
                                NC_000006.11:g.151962202C>T, NC_000006.12:g.151641067C>T

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center