Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 11

1.

rs12447690 [Homo sapiens]
    TGTGCATGTTCACAGAGCCATGGCA[C/T]CTTCCAATACCTGCTGAGCTCAGCC
    Chromosome:
    16:88264518
    Gene:
    LOC107984862 (GeneView)
    Functional Consequence:
    utr variant 5 prime
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.4599/2303
    HGVS:
    NC_000016.10:g.88264518C>T, NC_000016.9:g.88298124C>T, XM_017023969.1:c.-468G>A
    2.

    rs11245330 [Homo sapiens]
      ACCAAAAAAGATCAAACTAGTACAC[A/G]TGTGACCCTGGGTCCCCCACTGCAA
      Chromosome:
      10:124691769
      Gene:
      FAM53B (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1490/746
      HGVS:
      NC_000010.10:g.126380338G>A, NC_000010.11:g.124691769G>A, NM_014661.3:c.133+4389C>T, XM_005270299.1:c.133+4389C>T, XM_005270300.1:c.133+4389C>T
      3.

      rs9938149 [Homo sapiens]
        CTGCAATTGTCCCACAGGTCTTGTC[A/C]CCAGAAATCAAGTCCTTCTTCATCT
        Chromosome:
        16:88298034
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.2632/1318
        HGVS:
        NC_000016.10:g.88298034C>A, NC_000016.9:g.88331640C>A
        4.

        rs7500421 [Homo sapiens]
          GACACATTCCCTGTGCAGCAAATGG[G/T]TTGTGCAGACTGAGAACATGTCTGC
          Chromosome:
          16:88330877
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.1765/884
          HGVS:
          NC_000016.10:g.88330877T>G, NC_000016.9:g.88364483T>G
          5.

          rs7198446 [Homo sapiens]
            CCTCACGTGGATGGAACTCCCCCGG[A/C]CTGGAAGAAGGAGGGTTTTACGAGA
            Chromosome:
            16:88345763
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4661/2334
            HGVS:
            NC_000016.10:g.88345763A>C, NC_000016.9:g.88379369A>C
            6.

            rs7044529 [Homo sapiens]
              TTTCCAGAAGTAACCCCTCAACTCT[C/T]TGATCGGTATTGTTCTGGACTTACT
              Chromosome:
              9:134676205
              Gene:
              COL5A1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.2183/1093
              HGVS:
              NC_000009.11:g.137568051C>T, NC_000009.12:g.134676205C>T, NG_008030.1:g.39400C>T, NM_000093.4:c.110-14707C>T, NM_001278074.1:c.110-14707C>T, XM_017014266.1:c.110-14707C>T, XR_001746183.1:n.508-14707C>T
              7.

              rs4962399 [Homo sapiens]
                AGGCATTATGGTTGGTAGTATGCAC[A/G]TTTTCCAGATGGGAAGACTGAGGCT
                Chromosome:
                10:124713227
                Gene:
                FAM53B-AS1 (GeneView) FAM53B (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.1236/619
                HGVS:
                NC_000010.10:g.126401796A>G, NC_000010.11:g.124713227A>G, NM_014661.3:c.-174-6340T>C, NR_120630.1:n.445-207A>G, NR_120631.1:n.305-207A>G, XM_005270299.1:c.-174-6340T>C, XM_005270300.1:c.-174-6340T>C, XR_246199.1:n.552-207A>G
                8.

                rs2755238 [Homo sapiens]
                  TCCATTTCTTCAGGAAATTAATGAA[C/T]GGAAGGGCTGCTCTTAGCAGAGTCT
                  Chromosome:
                  13:40536133
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.0597/299
                  HGVS:
                  NC_000013.10:g.41110270T>C, NC_000013.11:g.40536133T>C
                  9.

                  rs2755237 [Homo sapiens]
                    CCTGGCAGGGCACACATCTGACGAA[A/C]AGAATTTTCCAGTGATGATTCTGAA
                    Chromosome:
                    13:40535292
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.2079/1041
                    HGVS:
                    NC_000013.10:g.41109429A>C, NC_000013.11:g.40535292A>C
                    10.

                    rs2721051 [Homo sapiens]
                      ACACATGATTCTTGGGAGCAGGTCC[A/G]TGCTGGCTGGCAGGATATTTGGCTC
                      Chromosome:
                      13:40536747
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.0659/330
                      HGVS:
                      NC_000013.10:g.41110884C>T, NC_000013.11:g.40536747C>T
                      11.

                      rs1006368 [Homo sapiens]
                        GCTGCCAAAGTGCCCACCCAGTTCC[A/G]TGGTCTTGGTAATATTTGTGGTTAG
                        Chromosome:
                        10:124658034
                        Gene:
                        FAM53B (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.1500/751
                        HGVS:
                        NC_000010.10:g.126346603C>T, NC_000010.11:g.124658034C>T, NM_014661.3:c.906+23573G>A, XM_005270299.1:c.906+23573G>A, XM_005270300.1:c.906+23573G>A

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center