Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 19

1.

rs11771145 [Homo sapiens]
    GGATTTGCCTGTTTTTAAACTTTAT[A/G]AAACGGAATCATCTGATATGCATTC
    Chromosome:
    7:143413669
    Gene:
    EPHA1-AS1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4321/2164
    HGVS:
    NC_000007.13:g.143110762G>A, NC_000007.14:g.143413669G>A, NR_033897.1:n.75-1399G>A
    2.

    rs11136000 [Homo sapiens]
      ACCAAAGCCACACCAGCTATCAAAA[C/T]TCTCTAACGGGCCCTTGCCACTTGA
      Chromosome:
      8:27607002
      Gene:
      CLU (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3782/1894
      HGVS:
      NC_000008.10:g.27464519T>C, NC_000008.11:g.27607002T>C, NG_027845.1:g.12809A>G, NM_001831.3:c.247-478A>G, NR_038335.1:n.568-478A>G, NR_045494.1:n.427-478A>G, XM_006716284.2:c.403-478A>G
      3.

      rs7527934 [Homo sapiens]
        CAAAACCATCTTCATACCCTTAACA[G/T]CTGCCTGAATTGCTGGGACAAACTG
        Chromosome:
        1:14031929
        Gene:
        KAZN (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2774/1389
        HGVS:
        NC_000001.10:g.14358424G>T, NC_000001.11:g.14031929G>T, XM_005245795.1:c.121+138173G>T, XM_005245795.4:c.121+138173G>T, XM_005245796.1:c.121+138173G>T, XM_011541074.2:c.121+138173G>T, XM_011541080.2:c.121+138173G>T, XM_017000768.1:c.121+138173G>T, XM_017000769.1:c.121+138173G>T, XM_017000770.1:c.121+138173G>T
        4.

        rs4420638 [Homo sapiens]
          AATGTCACTATGCTACACTTTTCCT[A/G]GTGTGGTCTACCCGAGATGAGGGGC
          Chromosome:
          19:44919689
          Gene:
          APOC1 (GeneView)
          Functional Consequence:
          downstream variant 500B
          Allele Origin:
          G(unknown)/A(germline,unknown)
          Clinical significance:
          untested
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency
          Global MAF:
          G=0.1510/756
          HGVS:
          NC_000019.10:g.44919689A>G, NC_000019.9:g.45422946A>G, NG_012859.1:g.10026A>G, NM_001321065.1:c.*459A>G, NM_001321066.1:c.*459A>G, NM_001645.4:c.*459A>G, XM_005258855.1:c.*459A>G
          5.

          rs4296166 [Homo sapiens]
            atgttgctaatctgataggtaaaac[A/G]tggtatttcagtgtgatttaatttt
            Chromosome:
            14:32483161
            Gene:
            AKAP6 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2516/1260
            HGVS:
            NC_000014.8:g.32952367A>G, NC_000014.9:g.32483161A>G, NM_004274.4:c.324+49344A>G, XM_005268219.1:c.324+49344A>G, XM_017021808.1:c.324+49344A>G
            6.

            rs3851179 [Homo sapiens]
              GCAAACAATACACACTTCAGTAAAT[A/G]TTATCTATCACAACTATTATATGGT
              Chromosome:
              11:86157598
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3149/1577
              HGVS:
              NC_000011.10:g.86157598T>C, NC_000011.9:g.85868640T>C
              7.

              rs3818361 [Homo sapiens]
                GTTAGATATGGGGCAATTTCCTTTG[C/T]TATATCTTATGCTTACCAGAGGGCT
                Chromosome:
                1:207611623
                Gene:
                CR1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.2486/1245
                HGVS:
                NC_000001.10:g.207784968A>G, NC_000001.11:g.207611623A>G, NG_007481.1:g.120496A>G, NM_000573.3:c.4946-54A>G, NM_000651.4:c.6296-54A>G, XM_005273064.1:c.5912-54A>G, XM_006711166.2:c.6311-54A>G, XM_011509205.1:c.6311-54A>G
                8.

                rs2825544 [Homo sapiens]
                  ATTAAAACTCTTCATTTACTCATCA[C/T]CTTCTATGTATAGCAGTGAAGTTTT
                  Chromosome:
                  21:19368235
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  C=0.3502/1754
                  HGVS:
                  NC_000021.8:g.20740552T>C, NC_000021.9:g.19368235T>C
                  9.

                  rs2075650 [Homo sapiens]
                    GAGATGAGAGTTGGTGTGGGGTTGG[A/G]GTGGAGTGTGACAGCGTTTCTCTTC
                    Chromosome:
                    19:44892362
                    Gene:
                    TOMM40 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.1194/598
                    HGVS:
                    NC_000019.10:g.44892362A>G, NC_000019.9:g.45395619A>G, NG_042854.1:g.6143A>G, NM_001128916.1:c.275-31A>G, NM_001128917.1:c.275-31A>G, NM_006114.2:c.275-31A>G, XM_005258411.1:c.275-31A>G, XM_005258411.3:c.275-31A>G
                    10.

                    rs2043948 [Homo sapiens]
                      TGTGCAGTCTAATTGTCCCCATCAC[C/T]CCCACCTTGTCTCCACAACCATCCA
                      Chromosome:
                      14:74606345
                      Gene:
                      LTBP2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      T=0.1512/757
                      HGVS:
                      NC_000014.8:g.75073048C>T, NC_000014.9:g.74606345C>T, NG_021486.1:g.10987G>A, NM_000428.2:c.495-2640G>A, XM_011536765.1:c.495-2640G>A
                      11.

                      rs1784933 [Homo sapiens]
                        AAGCAGTTCCAGGGTCTTAAATTGG[A/G]GATTTCAAGGAAATGAGATCATCGG
                        Chromosome:
                        11:121618707
                        Gene:
                        SORL1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        G=0.2300/1152
                        HGVS:
                        NC_000011.10:g.121618707G>A, NC_000011.9:g.121489416G>A, NG_023313.1:g.171456G>A, NM_003105.5:c.5605-67G>A, XM_005271652.1:c.2335-67G>A, XM_011542963.2:c.5491-67G>A, XM_011542965.2:c.4066-67G>A, XM_011542967.2:c.2437-67G>A, XM_017018169.1:c.5293-67G>A, XM_017018170.1:c.5080-67G>A, XM_017018172.1:c.2965-67G>A
                        12.

                        rs744373 [Homo sapiens]
                          CACCAGGGACAGGCAGGTCTGAGGC[C/T]CTCAGAGGCTGCCCATGATGCTGCC
                          Chromosome:
                          2:127137039
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.3580/1793
                          HGVS:
                          NC_000002.11:g.127894615A>G, NC_000002.12:g.127137039A>G
                          13.

                          rs597668 [Homo sapiens]
                            GTACAAGCATGATCATAAGAGAAAA[C/T]CTTGATAAATTAGATTCCATCAAAA
                            Chromosome:
                            19:45205630
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.3371/1688
                            HGVS:
                            NC_000019.10:g.45205630T>C, NC_000019.9:g.45708888T>C
                            15.

                            rs157582 [Homo sapiens]
                              TTTGGCTACAAATTTGTTATTAGAA[A/G]GATACAATGAATGGATGAAAAAGGA
                              Chromosome:
                              19:44892962
                              Gene:
                              TOMM40 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              T=0.2937/1471
                              HGVS:
                              NC_000019.10:g.44892962C>T, NC_000019.9:g.45396219C>T, NG_042854.1:g.6743C>T, NM_001128916.1:c.435+33C>T, NM_001128917.1:c.435+33C>T, NM_006114.2:c.435+33C>T, XM_005258411.1:c.435+33C>T, XM_005258411.3:c.435+33C>T
                              16.

                              rs10119 [Homo sapiens]
                                CAGAATCCTGCGTGCCCCTCAATTC[C/T]GGAATCCCTCCCGGGACCCCAGGCC
                                Chromosome:
                                19:44903416
                                Gene:
                                TOMM40 (GeneView)
                                Functional Consequence:
                                utr variant 3 prime
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                A=0.2476/1240
                                HGVS:
                                NC_000019.10:g.44903416G>A, NC_000019.9:g.45406673G>A, NG_007084.2:g.2635G>A, NG_042854.1:g.17197G>A, NM_001128916.1:c.*247G>A, NM_001128917.1:c.*247G>A, NM_006114.2:c.*247G>A
                                17.

                                rs6859 [Homo sapiens]
                                  CTTGGGACTTGGAGGGAGGTGGAAC[A/G]GCACACTGGACTTCTCCCGTCTCTA
                                  Chromosome:
                                  19:44878777
                                  Gene:
                                  NECTIN2 (GeneView)
                                  Functional Consequence:
                                  intron variant,utr variant 3 prime
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  A=0.3664/1835
                                  HGVS:
                                  NC_000019.10:g.44878777A>G, NC_000019.9:g.45382034A>G, NG_029149.1:g.37642A>G, NM_001042724.1:c.1043-3434A>G, NM_002856.2:c.*157A>G, XM_011527192.2:c.*157A>G
                                  18.

                                  rs6857 [Homo sapiens]
                                    ATGAGGCTCACCCTGTCTGACCCTA[A/G]GCTGGGGCTGCTTGCTTGGTAGGCA
                                    Chromosome:
                                    19:44888997
                                    Gene:
                                    NECTIN2 (GeneView)
                                    Functional Consequence:
                                    utr variant 3 prime
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                    Global MAF:
                                    T=0.1104/553
                                    HGVS:
                                    NC_000019.10:g.44888997C>T, NC_000019.9:g.45392254C>T, NG_029149.1:g.47862C>T, NG_042854.1:g.2778C>T, NM_001042724.1:c.*618C>T
                                    19.

                                    rs4362 [Homo sapiens]
                                      CGGCCTCGCTCTGCTCCAGGTACTT[C/T]GTCAGCTTCATCATCCAGTTCCAGT
                                      Chromosome:
                                      17:63496400
                                      Gene:
                                      ACE (GeneView)
                                      Functional Consequence:
                                      intron variant,synonymous codon
                                      Clinical significance:
                                      Benign
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      T=0.4125/2066
                                      HGVS:
                                      NC_000017.10:g.61573761T>C, NC_000017.11:g.63496400T>C, NG_011648.1:g.24328T>C, NM_000789.3:c.3387T>C, NM_001178057.1:c.1659-398T>C, NM_152830.2:c.1665T>C, NP_000780.1:p.Phe1129, NP_690043.1:p.Phe555, XM_005257110.1:c.2838T>C, XM_006721737.3:c.1725T>C, XP_005257167.1:p.Phe946, XP_006721800.2:p.Phe575

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center