Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs6449197 [Homo sapiens]
    aggttgaggaaattttatttctaat[C/T]tgctcagtgtttttttcatcacaag
    Chromosome:
    4:15813299
    Gene:
    CD38 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2632/1318
    HGVS:
    NC_000004.11:g.15814922C>T, NC_000004.12:g.15813299C>T, NM_001775.3:c.234-3212C>T, NR_132660.1:n.384-3212C>T, XR_241678.1:n.351-3212C>T
    2.

    rs3796863 [Homo sapiens]
      GGAGGGGAGCTATCCATGCCACCTG[A/C]TGGTCAAAAAAACAGCAGGAGCAGC
      Chromosome:
      4:15848363
      Gene:
      CD38 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4351/2179
      HGVS:
      NC_000004.11:g.15849986G>T, NC_000004.12:g.15848363G>T, NM_001775.3:c.840-176G>T, NR_132660.1:n.854-176G>T
      3.

      rs1800561 [Homo sapiens]
        GGCCCATCAGTTCACACAGGTCCAG[C/T]GGGACATGTTCACCCTGGAGGACAC
        Chromosome:
        4:15824935
        Gene:
        CD38 (GeneView)
        Functional Consequence:
        intron variant,missense
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.0008/4
        HGVS:
        NC_000004.11:g.15826558C>T, NC_000004.12:g.15824935C>T, NM_001775.3:c.418C>T, NP_001766.2:p.Arg140Trp, NR_132660.1:n.513+8295C>T, XR_241678.1:n.535C>T

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center