Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 28

1.

rs17827708 [Homo sapiens]
    AGAGTTCAGAGCAACTCAGTTTAGA[A/G]CTAAATAGTTATCCATGTTTTTATC
    Chromosome:
    18:67622458
    Gene:
    LOC105372174 (GeneView) LOC643542 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0845/423
    HGVS:
    NC_000018.10:g.67622458A>G, NC_000018.9:g.65289695A>G, NR_033921.1:n.204+105709A>G, XR_935590.2:n.2632+1330T>C
    2.

    rs16886165 [Homo sapiens]
      AAAGAAACTTGCCCAAGGCCAGCTT[C/G/T]TAATTGGTGGACCCAGTATTTGCAG
      Chromosome:
      5:56727256
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.2821/1413
      HGVS:
      NC_000005.10:g.56727256T>C, NC_000005.10:g.56727256T>G, NC_000005.9:g.56023083T>G
      3.

      rs13387042 [Homo sapiens]
        CCAGAACAGAAAGAAGGCAAATGGA[A/G]GCTACAGAAACCAAGGATTTCCTTG
        Chromosome:
        2:217041109
        Gene:
        LOC101928278 (GeneView) LOC105373874 (GeneView)
        Functional Consequence:
        intron variant,nc transcript variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.4742/2375
        HGVS:
        NC_000002.11:g.217905832A>G, NC_000002.12:g.217041109A>G, XR_001739169.1:n.11844+47091A>G, XR_001739170.1:n.8480+47091A>G, XR_001739171.1:n.8347+47091A>G, XR_923878.2:n.7422A>G
        4.

        rs12652447 [Homo sapiens]
          GTTTCTATTCAGAATGCAAACTCGC[A/G]TTATGAATTATCCTCTTCCTTTGGA
          Chromosome:
          5:15674526
          Gene:
          FBXL7 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.4976/2492
          HGVS:
          NC_000005.10:g.15674526G>A, NC_000005.9:g.15674635G>A, NM_001278317.1:c.-15+58454G>A, NM_012304.4:c.127+58454G>A, XM_005248273.1:c.112+58454G>A, XM_011513998.1:c.-92+58454G>A, XM_017009262.1:c.112+58454G>A
          5.

          rs10941679 [Homo sapiens]
            AAATGTGGGATGCTTTTTATTGACT[A/G]TGGAAAGAACACAGCATAAAAAAAG
            Chromosome:
            5:44706396
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.3161/1583
            HGVS:
            NC_000005.10:g.44706396A>G, NC_000005.9:g.44706498A>G
            6.

            rs9393597 [Homo sapiens]
              ATAAATTATGAAATGCTGAGTAATG[A/G]CTTTATTTTATGGGTGGAGACAGGG
              Chromosome:
              6:24972880
              Gene:
              FAM65B (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2460/1232
              HGVS:
              NC_000006.11:g.24973108A>G, NC_000006.12:g.24972880A>G, NG_051606.1:g.74409T>C, NM_001286446.2:c.76+68971T>C, XM_006715275.2:c.76+68971T>C, XM_006715281.3:c.76+68971T>C, XM_011515007.1:c.-442-36540T>C, XM_011515009.1:c.-27+31488T>C, XM_011515012.1:c.76+68971T>C, XR_001743760.1:n.432+68971T>C
              7.

              rs7629693 [Homo sapiens]
                TTTTCATAATTTGTTCATTGTTGTT[C/G]AGACTTTATCTTCCCTGACATATGC
                Chromosome:
                3:15367319
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.2530/1267
                HGVS:
                NC_000003.11:g.15408826G>C, NC_000003.12:g.15367319G>C
                8.

                rs7185203 [Homo sapiens]
                  AGGAGTGACCCACCCTTCTCTCCAA[C/T]GCATCGCTTACCCAGCCCTCCCTCC
                  Chromosome:
                  16:81605585
                  Gene:
                  CMIP (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.2983/1494
                  HGVS:
                  NC_000016.10:g.81605585C>T, NC_000016.9:g.81639190C>T, NG_029839.1:g.165416C>T, NM_030629.2:c.19-1982C>T, NM_198390.2:c.301-1982C>T, XM_005256179.1:c.85-1982C>T, XM_005256179.4:c.193-1982C>T, XM_011523352.1:c.301-1982C>T
                  9.

                  rs7090828 [Homo sapiens]
                    GGTTGCAGAGGTGGAAATAAGGCAA[C/T]GGGCACTCTTGTTTGTCTAGGAACC
                    Chromosome:
                    10:71049809
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.3329/1667
                    HGVS:
                    NC_000010.10:g.72809566T>C, NC_000010.11:g.71049809T>C
                    10.

                    rs6837016 [Homo sapiens]
                      GTTTTCTACAACACTCACGAAGGGA[C/T]TGATGATTTATTATTAGGAATGTCT
                      Chromosome:
                      4:154969089
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.3359/1682
                      HGVS:
                      NC_000004.11:g.155890241C>T, NC_000004.12:g.154969089C>T
                      11.

                      rs6735174 [Homo sapiens]
                        ATGAGGGTGGGATGGGGCAGTTAAA[A/C]GTTGAGGGGTATCTCTAGGAGAAAG
                        Chromosome:
                        2:217035557
                        Gene:
                        LOC101928278 (GeneView) LOC105373874 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.1242/622
                        HGVS:
                        NC_000002.11:g.217900280A>C, NC_000002.12:g.217035557A>C, XR_001739169.1:n.11844+41539A>C, XR_001739170.1:n.8480+41539A>C, XR_001739171.1:n.8347+41539A>C, XR_923878.2:n.4567+142A>C
                        12.

                        rs6602595 [Homo sapiens]
                          TCGGGCTGAGTCCTGCGGCAACCTC[A/G]CTTCTCACTGTTTCCTCCAAGCGAG
                          Chromosome:
                          10:12549917
                          Gene:
                          CAMK1D (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.4812/2410
                          HGVS:
                          NC_000010.10:g.12591916G>A, NC_000010.11:g.12549917G>A, NM_020397.3:c.93-3308G>A, NM_153498.3:c.93-3308G>A, XM_006717481.3:c.36-3308G>A, XM_006717482.3:c.93-3308G>A, XM_006717483.3:c.93-3308G>A, XM_011519591.2:c.54-3308G>A, XM_017016438.1:c.-199-3308G>A, XM_017016439.1:c.-199-3308G>A
                          15.

                          rs6138178 [Homo sapiens]
                            TCCCATGCCACCCTGTTTTAGCCCT[G/T]ACCTCTACCCAGTAATCTGCTATTC
                            Chromosome:
                            20:2467941
                            Gene:
                            SNRPB (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.4283/2145
                            HGVS:
                            NC_000020.10:g.2448587G>T, NC_000020.11:g.2467941G>T, NG_042057.1:g.7913C>A, NM_003091.3:c.4-183C>A, NM_198216.1:c.4-183C>A
                            16.

                            rs6005863 [Homo sapiens]
                              AGGTATGCTAATAGACGGCTGAAAA[A/C/G]TTGGCAGCCAAATTTGGTTTAAAGT
                              Chromosome:
                              22:28760460
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.4103/2055
                              HGVS:
                              NC_000022.10:g.29156448A>G, NC_000022.11:g.28760460A>C, NC_000022.11:g.28760460A>G
                              19.

                              rs4415084 [Homo sapiens]
                                TGTTGTATTCCTGATGACTTGAGCA[C/T]CCAAGGGAGTGATACATACAGCACT
                                Chromosome:
                                5:44662413
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.4645/2326
                                HGVS:
                                NC_000005.10:g.44662413C>T, NC_000005.9:g.44662515C>T
                                20.

                                rs3746687 [Homo sapiens]
                                  GTGTCCTTTTGTGCATGCTCAAGGC[C/T]GACTGATGGCTACAGTTGCCCGTAC
                                  Chromosome:
                                  20:2482946
                                  Gene:
                                  ZNF343 (GeneView)
                                  Functional Consequence:
                                  utr variant 3 prime
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.3738/1872
                                  HGVS:
                                  NC_000020.10:g.2463592T>C, NC_000020.11:g.2482946T>C, NM_001282495.1:c.*215A>G, NM_001282496.1:c.*215A>G, NM_001282497.1:c.*215A>G, NM_001282498.1:c.*215A>G, NM_001321800.1:c.*215A>G, NM_001321801.1:c.*215A>G, NM_001321802.1:c.*215A>G, NM_001321803.1:c.*215A>G, NM_001321805.1:c.*215A>G, NM_024325.5:c.*215A>G, XM_017028062.1:c.*215A>G

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center