Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from

Items: 2

1.

rs10811661 [Homo sapiens]
    CAGCTCACCTCCAGCTTTAGTTTTC[C/T]CATGACAGTAAGTCTATTACCCTCC
    Chromosome:
    9:22134095
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1763/883
    HGVS:
    NC_000009.11:g.22134094T>C, NC_000009.12:g.22134095T>C
    2.

    rs2891168 [Homo sapiens]
      TAACAAAAGATGTCCTGTTTGGAAC[A/G]CCAACTCTGTATCAGTTACTTCAGA
      Chromosome:
      9:22098620
      Gene:
      CDKN2B-AS1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      G=0.4030/2018
      HGVS:
      NC_000009.11:g.22098619A>G, NC_000009.12:g.22098620A>G, NR_003529.3:n.2698+1256A>G, NR_047532.1:n.1487+1256A>G, NR_047534.1:n.751+1256A>G, NR_047535.1:n.781-13700A>G, NR_047536.1:n.645-13700A>G, NR_047537.1:n.781-21580A>G, NR_047538.1:n.645-21580A>G, NR_047543.1:n.781-13700A>G, NR_120536.1:n.645-21884A>G

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center