Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 31

1.

rs13095226 [Homo sapiens]
    CTAACACCAGATAACAGGAATGGCC[C/T]TCAGGAAACTTTCCACAGAAGCCTT
    Chromosome:
    3:99677428
    Gene:
    COL8A1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0747/374
    HGVS:
    NC_000003.11:g.99396272T>C, NC_000003.12:g.99677428T>C, NM_001850.4:c.-129+1707T>C, NM_020351.3:c.-129+38764T>C, XM_005247098.1:c.-129+1707T>C, XM_005247099.1:c.-129+38764T>C
    2.

    rs12678919 [Homo sapiens]
      ctctccaaaagtacaagatgacacc[A/G]ttctctgaagttcccatatccacct
      Chromosome:
      8:19986711
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1060/531
      HGVS:
      NC_000008.10:g.19844222A>G, NC_000008.11:g.19986711A>G
      3.

      rs12637095 [Homo sapiens]
        AAAACCAGGGGTGTCCAGATACTCA[A/T]GATGCAACAATCCCCTGGGCCCACC
        Chromosome:
        3:118473456
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2768/1386
        HGVS:
        NC_000003.11:g.118192303T>A, NC_000003.12:g.118473456T>A
        4.

        rs11755724 [Homo sapiens]
          ATTTAGCGTCCTTTTGAAAATAGTC[A/G]GTTTTTCACCACCAAATTTGCCAAT
          Chromosome:
          6:7118757
          Gene:
          RREB1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.2907/1456
          HGVS:
          NC_000006.11:g.7118990A>G, NC_000006.12:g.7118757A>G, NG_016201.1:g.16161A>G, NM_001003698.3:c.-285+10697A>G, NM_001003699.3:c.-285+10697A>G, NM_001003700.1:c.-285+10697A>G, NM_001168344.1:c.-285+10989A>G, XM_005249272.1:c.-908+10055A>G, XM_005249275.1:c.-285+10055A>G, XM_005249277.1:c.-908+10697A>G, XM_011514794.2:c.-237+10697A>G, XM_011514795.2:c.-285+10697A>G
          5.

          rs10737680 [Homo sapiens]
            TCTTTGCTGCAAACCCTACTGTCTC[A/C]GCGTATTGGTCTATTGCTAAACAGT
            Chromosome:
            1:196710325
            Gene:
            CFH (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.4796/2402
            HGVS:
            NC_000001.10:g.196679455A>C, NC_000001.11:g.196710325A>C, NG_007259.1:g.63315A>C, NM_000186.3:c.1337-3410A>C, XR_001737134.1:n.1459-3410A>C
            6.

            rs10490924 [Homo sapiens]
              TTTATCACACTCCATGATCCCAGCT[G/T]CTAAAATCCACACTGAGCTCTGCTT
              Chromosome:
              10:122454932
              Gene:
              ARMS2 (GeneView) LOC105378525 (GeneView)
              Functional Consequence:
              downstream variant 500B,intron variant,missense
              Allele Origin:
              G(germline)/T(germline)
              Clinical significance:
              other
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.2865/1435
              HGVS:
              NC_000010.10:g.124214448G>T, NC_000010.11:g.122454932G>T, NG_011725.1:g.5270G>T, NM_001099667.1:c.205G>T, NP_001093137.1:p.Ala69Ser, XR_946382.2:n.1855+3563C>A, XR_946383.2:n.1855+3563C>A, XR_946384.2:n.1580+3563C>A, XR_946385.2:n.1945C>A
              7.

              rs10468017 [Homo sapiens]
                GGCACAGTGACGGGCAGACTTGCAA[C/T]ATTTCATGGGTGGATGCACTGAAAG
                Chromosome:
                15:58386313
                Gene:
                LOC101928635 (GeneView)
                Functional Consequence:
                intron variant,nc transcript variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.1927/965
                HGVS:
                NC_000015.10:g.58386313C>T, NC_000015.9:g.58678512C>T, XR_001751556.1:n.582+33658G>A, XR_001751557.1:n.582+33658G>A, XR_001751558.1:n.582+33658G>A, XR_001751559.1:n.582+33658G>A, XR_001751560.1:n.582+33658G>A, XR_001751563.1:n.582+33658G>A, XR_001751565.1:n.2766G>A, XR_429537.3:n.582+33658G>A
                8.

                rs10033900 [Homo sapiens]
                  AGTCAGGTCATCTCACTCCTGCTGT[C/T]CCTGGTCTCTGTCACATAGAGTCGC
                  Chromosome:
                  4:109737911
                  Gene:
                  CFI (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.4948/2478
                  HGVS:
                  NC_000004.11:g.110659067T>C, NC_000004.12:g.109737911T>C, XM_011531920.1:c.1558+4580A>G, XM_017008164.1:c.1534+4580A>G, XM_017008165.1:c.1513+4580A>G, XM_017008166.1:c.1535-3111A>G
                  10.

                  rs7690921 [Homo sapiens]
                    GCATTAAAAAATCTGGATCAGTATG[A/T]TACAGCCACCGTGTTGTGACTTTGG
                    Chromosome:
                    4:109657590
                    Gene:
                    CCDC109B (GeneView) LOC107986302 (GeneView) MCUB (GeneView)
                    Functional Consequence:
                    intron variant,upstream variant 2KB
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.2348/1176
                    HGVS:
                    NC_000004.11:g.110578746T>A, NC_000004.12:g.109657590T>A, NM_017918.4:c.100-1421T>A, XM_006714246.3:c.13-1421T>A, XR_001741791.1:n.-1238A>T
                    11.

                    rs4939883 [Homo sapiens]
                      GGGGTGAGAGGAGCCAGCAGGTGAA[C/T]GGAGCTAAGGATCATGAAATATCCC
                      Chromosome:
                      18:49640844
                      Gene:
                      LOC105372112 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.2498/1251
                      HGVS:
                      NC_000018.10:g.49640844T>C, NC_000018.9:g.47167214T>C, XR_001753446.1:n.898-21190T>C
                      12.

                      rs4846914 [Homo sapiens]
                        CTGCTGTGCCTTCTGGGACTGCCAA[A/G]AGTTGCCAAGGGGAGTGGGGAGTCC
                        Chromosome:
                        1:230159944
                        Gene:
                        GALNT2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.3339/1672
                        HGVS:
                        NC_000001.10:g.230295691G>A, NC_000001.11:g.230159944G>A, NG_011854.2:g.107156G>A, NM_001291866.1:c.13-18274G>A, NM_004481.4:c.127-18274G>A, XM_017000963.1:c.127-18274G>A, XM_017000964.1:c.34-18274G>A, XM_017000965.1:c.13-18274G>A, XM_017000966.1:c.-75-18274G>A
                        13.

                        rs3764261 [Homo sapiens]
                          CCTTCACCTGTCGGTAGGCATCTGG[G/T]TTGTCTGCtatctcattcactcttc
                          Chromosome:
                          16:56959412
                          Allele Origin:
                          G(germline)/T(germline,unknown)
                          Clinical significance:
                          untested
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.2895/1450
                          HGVS:
                          NC_000016.10:g.56959412C>A, NC_000016.9:g.56993324C>A, NG_008952.1:g.2490C>A
                          14.

                          rs3748391 [Homo sapiens]
                            GGGGCTCTTGAAACAGTGGTGAGAG[A/G/T]TTACCTGCTCTTCCTGGCACATCCT
                            Chromosome:
                            16:87255411
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.3466/1736
                            HGVS:
                            NC_000016.10:g.87255411T>A, NC_000016.10:g.87255411T>G, NC_000016.9:g.87289017T>G
                            15.

                            rs2967605 [Homo sapiens]
                              TGGGCCCTCCTCCGGTGTCAGTTTA[A/G]GGTGGAGACATCTGGCATCACCAAC
                              Chromosome:
                              19:8404854
                              Gene:
                              RAB11B (GeneView)
                              Functional Consequence:
                              downstream variant 500B
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              T=0.3087/1546
                              HGVS:
                              NC_000019.10:g.8404854C>T, NC_000019.9:g.8469738C>T, NM_004218.3:c.*876+420C>T
                              16.

                              rs2338104 [Homo sapiens]
                                tgaaaaagttctaaaattagatagt[C/G]gttatggcctcacaacttgtgaata
                                Chromosome:
                                12:109457363
                                Gene:
                                KCTD10 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.4669/2338
                                HGVS:
                                NC_000012.11:g.109895168C>G, NC_000012.12:g.109457363C>G, NM_001317395.1:c.530+267G>C, NM_001317399.1:c.527+267G>C, NM_031954.4:c.527+267G>C, NR_133897.1:n.639+267G>C, NR_133898.1:n.595+267G>C, XM_005253945.1:c.554+267G>C, XM_005253946.1:c.530+267G>C
                                17.

                                rs2271293 [Homo sapiens]
                                  GCCTGGGCCCAGGGTCAATGGGGTA[A/G]AAGATGTTGATAGTGTAATGTTTGG
                                  Chromosome:
                                  16:67868167
                                  Gene:
                                  NUTF2 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  A=0.0996/499
                                  HGVS:
                                  NC_000016.10:g.67868167G>A, NC_000016.9:g.67902070G>A, NM_001322038.1:c.100-173G>A, NM_001322039.1:c.100-173G>A, NM_001322040.1:c.100-173G>A, NM_001322041.1:c.100-173G>A, NM_005796.2:c.100-173G>A, XM_005255771.1:c.100-173G>A
                                  18.

                                  rs2230199 [Homo sapiens]
                                    CAGGGAGTTCAAGTCAGAAAAGGGG[A/C/G]GCAACAAGTTCGTGACCGTGCAGGC
                                    Chromosome:
                                    19:6718376
                                    Gene:
                                    C3 (GeneView)
                                    Functional Consequence:
                                    missense
                                    Allele Origin:
                                    G(germline)/C(germline)
                                    Clinical significance:
                                    other
                                    Validated:
                                    by 1000G,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    C=0.0873/437
                                    HGVS:
                                    NC_000019.10:g.6718376G>C, NC_000019.10:g.6718376G>T, NC_000019.9:g.6718387G>C, NC_000019.9:g.6718387G>T, NG_009557.1:g.7276C>A, NG_009557.1:g.7276C>G, NM_000064.2:c.304C>A, NM_000064.2:c.304C>G, NM_000064.3:c.304C>A, NM_000064.3:c.304C>G, NP_000055.2:p.Arg102Gly, NP_000055.2:p.Arg102Ser

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center