Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs10473984 [Homo sapiens]
    AATTTACAGTACCTTTACAGAAGGA[G/T]AAAGGTGCCTTCTTCAAAAGGTTTT
    Chromosome:
    5:76971301
    Gene:
    CRHBP (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1074/538
    HGVS:
    NC_000005.10:g.76971301G>T, NC_000005.9:g.76267126G>T, XR_948235.2:n.1234-5064G>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center