Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs1800497 [Homo sapiens]
    TGGACGTCCAGCTGGGCGCCTGCCT[C/T]GACCAGCACTTTGAGGATGGCTGTG
    Chromosome:
    11:113400106
    Gene:
    ANKK1 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    A=0.3257/1631
    HGVS:
    NC_000011.10:g.113400106G>A, NC_000011.9:g.113270828G>A, NG_012976.1:g.17316G>A, NM_178510.1:c.2137G>A, NP_848605.1:p.Glu713Lys, XM_011542736.2:c.2170G>A, XM_011542737.2:c.2140G>A, XM_011542738.2:c.1948G>A, XM_017017475.1:c.2167G>A, XP_011541038.1:p.Glu724Lys, XP_011541039.1:p.Glu714Lys, XP_011541040.1:p.Glu650Lys, XP_016872964.1:p.Glu723Lys
    2.

    rs77905 [Homo sapiens]
      CCACTGTGGCCAGCTCCCGGTCTTC[C/T]GTGTTGTACGTGCAGGAGGTGATGA
      Chromosome:
      9:133652975
      Gene:
      DBH (GeneView)
      Functional Consequence:
      synonymous codon
      Clinical significance:
      Benign
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.3788/1897
      HGVS:
      NC_000009.11:g.136518097A>G, NC_000009.12:g.133652975A>G, NG_008645.1:g.21613A>G, NM_000787.3:c.1410A>G, NP_000778.3:p.Thr470

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center